ID: 1083183948

View in Genome Browser
Species Human (GRCh38)
Location 11:61006965-61006987
Sequence CATGCATCTTTGCATACAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 164}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083183948_1083183952 -10 Left 1083183948 11:61006965-61006987 CCTACTGTATGCAAAGATGCATG 0: 1
1: 0
2: 2
3: 17
4: 164
Right 1083183952 11:61006978-61007000 AAGATGCATGCTAGCACTGGGGG 0: 1
1: 0
2: 0
3: 10
4: 106
1083183948_1083183955 10 Left 1083183948 11:61006965-61006987 CCTACTGTATGCAAAGATGCATG 0: 1
1: 0
2: 2
3: 17
4: 164
Right 1083183955 11:61006998-61007020 GGGTACAATCCTGGGCTAAAAGG 0: 1
1: 0
2: 0
3: 7
4: 93
1083183948_1083183954 2 Left 1083183948 11:61006965-61006987 CCTACTGTATGCAAAGATGCATG 0: 1
1: 0
2: 2
3: 17
4: 164
Right 1083183954 11:61006990-61007012 AGCACTGGGGGTACAATCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 99
1083183948_1083183960 19 Left 1083183948 11:61006965-61006987 CCTACTGTATGCAAAGATGCATG 0: 1
1: 0
2: 2
3: 17
4: 164
Right 1083183960 11:61007007-61007029 CCTGGGCTAAAAGGGGCAGGTGG 0: 1
1: 0
2: 0
3: 22
4: 307
1083183948_1083183958 16 Left 1083183948 11:61006965-61006987 CCTACTGTATGCAAAGATGCATG 0: 1
1: 0
2: 2
3: 17
4: 164
Right 1083183958 11:61007004-61007026 AATCCTGGGCTAAAAGGGGCAGG 0: 1
1: 0
2: 1
3: 26
4: 221
1083183948_1083183953 1 Left 1083183948 11:61006965-61006987 CCTACTGTATGCAAAGATGCATG 0: 1
1: 0
2: 2
3: 17
4: 164
Right 1083183953 11:61006989-61007011 TAGCACTGGGGGTACAATCCTGG 0: 1
1: 0
2: 0
3: 3
4: 92
1083183948_1083183957 12 Left 1083183948 11:61006965-61006987 CCTACTGTATGCAAAGATGCATG 0: 1
1: 0
2: 2
3: 17
4: 164
Right 1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG 0: 1
1: 0
2: 0
3: 1
4: 87
1083183948_1083183956 11 Left 1083183948 11:61006965-61006987 CCTACTGTATGCAAAGATGCATG 0: 1
1: 0
2: 2
3: 17
4: 164
Right 1083183956 11:61006999-61007021 GGTACAATCCTGGGCTAAAAGGG 0: 1
1: 0
2: 0
3: 1
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083183948 Original CRISPR CATGCATCTTTGCATACAGT AGG (reversed) Intronic
901196798 1:7444871-7444893 CATGGTTCCTGGCATACAGTAGG - Intronic
902232846 1:15038872-15038894 CATTCATGTCTGTATACAGTAGG - Intronic
902232850 1:15038982-15039004 CATTCATGTCTGTATACAGTAGG - Intronic
902232853 1:15039092-15039114 CATTCATGTCTGTATACAGTAGG - Intronic
902661600 1:17908047-17908069 CTTGCAGCTTTGCAGATAGTAGG - Intergenic
902665821 1:17937239-17937261 CAGGCATCTTTCCATACATCAGG + Intergenic
903505963 1:23836054-23836076 AAAGAATCTTTGCATACACTAGG + Intronic
903841082 1:26241174-26241196 CATGCTGCCTTGCATAGAGTAGG + Intronic
910010516 1:82455579-82455601 CATTCATCTTTGATTACAGAAGG - Intergenic
911052695 1:93684665-93684687 TATGCATCTTGGCACACAGTAGG - Intronic
913214199 1:116606804-116606826 CATGGTGCTTTGCATAGAGTAGG - Intronic
913456470 1:119036727-119036749 CATGCATCTTTGCCTGATGTCGG + Intronic
917660566 1:177173253-177173275 CATGCATCTTTTCCTAGAGTAGG - Intronic
918441210 1:184568950-184568972 TATCCATCTTTGTATATAGTAGG - Intronic
918824337 1:189302604-189302626 CATGCATATTTTAATACAGAAGG + Intergenic
922072129 1:222204905-222204927 GATCCACCTTTGCTTACAGTGGG - Intergenic
922434431 1:225589698-225589720 CATCCTTCTCTGTATACAGTTGG - Intronic
923873676 1:238023665-238023687 CATGCATGTCTTCATACAGTTGG + Intergenic
924266556 1:242288124-242288146 GTTTCATCTTTGCCTACAGTCGG - Intronic
924424977 1:243942541-243942563 CATACATCATTGCATTCTGTGGG - Intergenic
1066718276 10:38310432-38310454 GTTTCATCTTTGCCTACAGTCGG + Intergenic
1067156429 10:43784807-43784829 CATCCTTCTTTACGTACAGTTGG - Intergenic
1067469150 10:46523600-46523622 CCTGAATCTGTGCATACAGCAGG - Intergenic
1067550662 10:47233385-47233407 CATGCATCTTTGCAAAAATGTGG - Intergenic
1068622039 10:59196846-59196868 AATCCATCTTTGAATACATTGGG - Intronic
1071429702 10:85597132-85597154 CAGGCAGCTTTGCAGACAGCAGG + Intergenic
1073889125 10:108077525-108077547 CATGCATCTCTGCTCTCAGTTGG - Intergenic
1074318832 10:112382262-112382284 CATGCTTCTATGCACACAGCAGG - Intronic
1074751232 10:116589318-116589340 CATGCCTCTGTGGTTACAGTGGG + Intergenic
1075262183 10:120972807-120972829 AATGCCTCTTTGCACTCAGTAGG - Intergenic
1078523568 11:12083598-12083620 CCTGCATCTCTGGACACAGTGGG - Intergenic
1079752048 11:24212383-24212405 CATGGATCCTTGCAGCCAGTTGG + Intergenic
1080136537 11:28861261-28861283 CAAGCATCTTTGCAAATATTTGG + Intergenic
1080148768 11:29023230-29023252 CATGGATCATTGCATTCATTTGG - Intergenic
1080324908 11:31059790-31059812 TATGTAGCTTTGCATATAGTTGG - Intronic
1080997019 11:37616294-37616316 CTTACATATTTGCATATAGTAGG - Intergenic
1082680380 11:56161091-56161113 AATGCATCTCAGCATACAGGTGG - Intergenic
1083183948 11:61006965-61006987 CATGCATCTTTGCATACAGTAGG - Intronic
1083445121 11:62703284-62703306 CATGCAAATTTGCCTACAATTGG - Intronic
1087193484 11:95281181-95281203 CATGAATCTGTACATACATTAGG + Intergenic
1090140309 11:124251500-124251522 CATACATCTTAGCATAGAATAGG - Intergenic
1090868941 11:130726059-130726081 AATGCAGCATTGCATACTGTTGG + Intergenic
1090913990 11:131146343-131146365 AATGCATATTTGCACACACTGGG + Intergenic
1097176585 12:57146942-57146964 CCTGCATCTTGCCATACAGTGGG + Intronic
1100412177 12:94330806-94330828 CATGCATTTTTCCATACAGAAGG - Intronic
1103129884 12:118458871-118458893 GATGCTTATTTGCATCCAGTGGG + Intergenic
1105217415 13:18297357-18297379 CATGGTGCTTTGCATAGAGTAGG - Intergenic
1106404423 13:29461462-29461484 TATGTATCTTTGTATACTGTAGG - Intronic
1106858282 13:33876076-33876098 CAAGAATCTTTGGATACAATAGG - Intronic
1107039035 13:35929627-35929649 CATACATGTTTGCTTAGAGTAGG - Intronic
1107277563 13:38693548-38693570 CATGCAACTTTCATTACAGTGGG + Intronic
1108488729 13:50956785-50956807 AATGCAACTTTGCATTCAGTAGG + Intronic
1110128722 13:71979773-71979795 CATGCATATTTGCCTTTAGTGGG - Intergenic
1110152988 13:72277144-72277166 CATTCATATATGCATACATTTGG - Intergenic
1114157199 14:20118257-20118279 CATGCATCTTTATCTACATTTGG + Exonic
1114207445 14:20586079-20586101 CATTCCTCTTTGCTCACAGTAGG + Intronic
1121435745 14:93918128-93918150 CATGTATCTTTGCATGCAGTAGG - Intergenic
1126164506 15:45643151-45643173 CTTGCATCCTTACATACAGTGGG + Intronic
1128332033 15:66762299-66762321 GGTGCATCCTTGCACACAGTAGG + Intronic
1130093115 15:80837707-80837729 CAAGCATCTTTGCATTTATTTGG + Intronic
1135764859 16:25168813-25168835 CTTGCATCTTAGCATACATGTGG + Intronic
1138520400 16:57567778-57567800 CATGCACCTATGCACCCAGTGGG + Intronic
1141281967 16:82637060-82637082 CATGCATCTTTGCAGCAAATTGG - Intronic
1142330350 16:89448136-89448158 CATGCACCCTTGCAGACACTGGG + Intronic
1142782460 17:2191820-2191842 CATGCAACTTTGACGACAGTTGG - Intronic
1147962347 17:44175725-44175747 CATGCATCCTTACATACTGCAGG - Intronic
1149089393 17:52760391-52760413 CAAGCATCTTTTCATTGAGTCGG + Intergenic
1149221346 17:54418302-54418324 CAGGAAACTTTGCATTCAGTTGG - Intergenic
1149282109 17:55118085-55118107 CATCCATCCTTGCATACTATGGG - Intronic
1150533379 17:66009843-66009865 CATGCTGTTTTGCTTACAGTAGG + Intronic
1153923085 18:9808398-9808420 CATTCAACTCTGCATACACTCGG + Intronic
1157889130 18:51397840-51397862 CATTTATATTTGCCTACAGTTGG - Intergenic
1158150969 18:54369902-54369924 CATTTGTCTTTGTATACAGTTGG + Intronic
1162317602 19:9949513-9949535 CATACACATTTGGATACAGTTGG + Intergenic
1167092074 19:47351413-47351435 AATGCCTTTTTGCTTACAGTTGG - Intronic
929245151 2:39693744-39693766 GAACCATCTTGGCATACAGTTGG - Intronic
930353159 2:50283110-50283132 CATGCCTCCTGGCACACAGTAGG + Intronic
930659370 2:54038618-54038640 GGTGATTCTTTGCATACAGTAGG + Intronic
931257750 2:60588451-60588473 CATGCTTCTTGGCATAAAATAGG + Intergenic
933304467 2:80579959-80579981 ACTGCCTCTTGGCATACAGTAGG - Intronic
933806620 2:86002988-86003010 CAGCCATCTCTGCATACAGAGGG - Intergenic
934296905 2:91749326-91749348 CATGGTGCTTTGCATAGAGTAGG + Intergenic
935612418 2:105038715-105038737 CCTGCATCTTTCCATAGAGGGGG - Intronic
937812094 2:126210772-126210794 CATACATTTTTGCATATATTAGG - Intergenic
939871817 2:147534423-147534445 CTTGCATCTTTGCTCAGAGTAGG + Intergenic
940993791 2:160125208-160125230 CATGATTCTTGGCATATAGTAGG + Intronic
944133506 2:196372541-196372563 TATGAATCTGTGCATACAATGGG + Intronic
946750081 2:222885652-222885674 CATGCATCTATTCATCCAGGGGG - Intronic
947234018 2:227921064-227921086 CCTGCATCTTTGCACAGAGAAGG + Intronic
947436530 2:230077602-230077624 CATGAATCTTTGCTTACCCTTGG - Intergenic
1170140328 20:13119577-13119599 TATGCATATTTGGATACAGAGGG + Intronic
1170209799 20:13837010-13837032 AAGGCATATTTACATACAGTGGG + Intergenic
1170904995 20:20506305-20506327 CATACTGCTTTGCATATAGTAGG + Intronic
1174974826 20:55319991-55320013 AATGCTTCTTTGCATCCAGTGGG + Intergenic
1178717262 21:34977242-34977264 CATCGATCTTTGGGTACAGTGGG - Intronic
1178944191 21:36932689-36932711 CTAGAAGCTTTGCATACAGTAGG - Intronic
1181998943 22:26904340-26904362 GATGCATCTCTGCATCCAGCTGG + Intergenic
1182316591 22:29451586-29451608 CATGAAGCTGGGCATACAGTAGG - Intergenic
1182949141 22:34355172-34355194 CATGCACCTTTGCAAACTGGAGG - Intergenic
949839271 3:8302504-8302526 CAAGCAGCTTGGCACACAGTAGG - Intergenic
953474648 3:43195061-43195083 AATGCAGCTTTGCAAACAGTGGG - Intergenic
954592003 3:51790890-51790912 CATGCATCTCTGCCAACAGTAGG + Intergenic
955683340 3:61525536-61525558 CATGCTGCTTGGCACACAGTAGG - Intergenic
956079900 3:65547569-65547591 CCTGCTTCTTTGCAGAAAGTGGG - Intronic
957351692 3:79031041-79031063 CATGCATACTTGAATTCAGTAGG + Intronic
960340760 3:116472285-116472307 CATGCCTCTTTCCATCCCGTTGG + Intronic
960580526 3:119274603-119274625 TATTCATCTTTGCATTCACTGGG + Intergenic
962706988 3:138053107-138053129 CCTGCATCTTTACATCCAGCAGG + Intergenic
966297356 3:178439836-178439858 CGTGGATTTTTCCATACAGTGGG - Intronic
968282814 3:197489884-197489906 CATGCACCATTGCATCCAGAAGG - Intergenic
970050630 4:11910752-11910774 CATTCAACTTTGCACATAGTAGG + Intergenic
970533683 4:17007535-17007557 CATGCATTTTTGCATACATATGG - Intergenic
970617182 4:17779442-17779464 CATGATTCTTGGCACACAGTAGG - Intronic
972925717 4:44003902-44003924 CATGCATCTTTGTATGCTGCAGG + Intergenic
974073980 4:57151776-57151798 CATACAGCCTAGCATACAGTAGG + Intergenic
975025165 4:69539836-69539858 AATGCATCTTTATAAACAGTTGG - Intergenic
976409620 4:84698599-84698621 CATGCATCCTTGGATACACATGG - Intronic
976470294 4:85420445-85420467 CAGGCATTGTTGCATACAGCAGG + Intergenic
977629496 4:99225930-99225952 CAGGAATCTTTGCACACTGTTGG - Intergenic
978331575 4:107618866-107618888 CAAGCATTTTTGGATATAGTTGG - Intronic
978840410 4:113205694-113205716 CATTTATCATTGCATATAGTGGG - Intronic
981979977 4:150780275-150780297 CATTCATTTTAGCATTCAGTAGG + Intronic
982507235 4:156234866-156234888 TCTGAATCTTTGCATACTGTTGG - Intergenic
984291448 4:177800189-177800211 AATGCATCTTTCCTTTCAGTGGG + Intronic
986226815 5:5823553-5823575 CAGGCATCTTTGGACACTGTCGG - Intergenic
986474715 5:8115876-8115898 CATGTCACTTTCCATACAGTTGG - Intergenic
989468271 5:41783647-41783669 CAGACTTCTTTGCATAGAGTGGG - Intronic
989799565 5:45520694-45520716 CATTCATCTATGCATTCATTTGG + Intronic
990072687 5:51804620-51804642 CATGAATTTTTGCATTCTGTTGG - Intergenic
994581915 5:101653981-101654003 CATGCAACCTGGCATACAGTAGG - Intergenic
994634569 5:102328173-102328195 CATGCTGCGTTGCTTACAGTGGG - Intergenic
996227679 5:121020976-121020998 GGTGCATCTTTGCATTCAATGGG + Intergenic
999208129 5:149864749-149864771 CAGGCATCTCTGAACACAGTCGG - Intronic
999918458 5:156289850-156289872 CATACTACTTTGCATACAGTAGG - Intronic
1000929403 5:167232790-167232812 CATAGAGCTTTGCATATAGTAGG - Intergenic
1001988343 5:176094892-176094914 CAAGCACCTTTGCCAACAGTCGG - Intronic
1002228525 5:177743242-177743264 CAAGCACCTTTGCCAACAGTCGG + Intronic
1008697518 6:54057480-54057502 CTTGCATATTTGCATTCAGGGGG + Intronic
1015913442 6:138190979-138191001 CATGGATCCATGAATACAGTTGG - Intronic
1017188836 6:151630114-151630136 CATGCCTCTTTCACTACAGTGGG + Intergenic
1017598134 6:156051971-156051993 ACTGCATGTTTGCATCCAGTGGG + Intergenic
1018906104 6:168077014-168077036 CATGCATCTGTGTCTGCAGTTGG - Intronic
1018906122 6:168077155-168077177 CATGCATCTGTGTCTGCAGTAGG - Intronic
1020464995 7:8467364-8467386 CATGCACATTTGCATATAGTTGG + Intronic
1021842165 7:24729617-24729639 CATGCCTCTGTGCAGACAGGAGG + Intronic
1022778459 7:33553266-33553288 CATGAAACTTAGAATACAGTGGG - Intronic
1024357341 7:48427557-48427579 CATTCATCTTTGCATCCTATGGG + Intronic
1026066453 7:67078050-67078072 CATGCTGCTTTGGTTACAGTAGG + Intronic
1026418743 7:70210839-70210861 CATGCAACGATGCATACAATGGG - Intronic
1026626935 7:72002308-72002330 CATTTATGTTAGCATACAGTTGG + Intronic
1028177216 7:87672724-87672746 CATGAATCTTTGCAAACCTTGGG - Intronic
1031728628 7:125269001-125269023 CATGAATCTTTGGATACAAGGGG - Intergenic
1033062686 7:138123280-138123302 CAAGCATCTTGGCTAACAGTGGG + Intergenic
1033518508 7:142134653-142134675 AATGCATATTTGGATCCAGTGGG - Intronic
1033622846 7:143077685-143077707 CAGGAAACTTTGCATTCAGTTGG - Intergenic
1037720624 8:21440512-21440534 CGTGCATGCATGCATACAGTTGG + Intergenic
1037827305 8:22167007-22167029 CATGCATCTTCCCATAGAGTTGG + Intronic
1038069202 8:23994702-23994724 CAATAAACTTTGCATACAGTAGG - Intergenic
1041096434 8:54355004-54355026 CATGCATCTCTGCATGCAGCTGG + Intergenic
1044527823 8:93271681-93271703 CATGGTCCTTAGCATACAGTAGG - Intergenic
1044561859 8:93620025-93620047 CATGTGTCTTTGGACACAGTGGG - Intergenic
1045055729 8:98366871-98366893 CATGCTGCCTAGCATACAGTGGG - Intergenic
1045873791 8:106955174-106955196 CATGCATCTTTCCATAAATGTGG - Intergenic
1046394564 8:113625264-113625286 CAGGAATCTTTGCATTCAATTGG - Intergenic
1048060296 8:130912480-130912502 CATCCTGCTTTCCATACAGTAGG + Intronic
1048684954 8:136894307-136894329 CATCCTTCTATCCATACAGTCGG - Intergenic
1051487959 9:17628927-17628949 CATGGATCTTTATAAACAGTTGG - Intronic
1052782194 9:32792845-32792867 AAGGAATCTTTGCACACAGTGGG + Intergenic
1056038170 9:82631380-82631402 CATGCATCTTTGCAAACATTAGG + Intergenic
1056125560 9:83533793-83533815 CATAGTGCTTTGCATACAGTAGG - Intronic
1056856875 9:90139332-90139354 CATTCATCTTTACATAAAATTGG + Intergenic
1187078538 X:15961397-15961419 CATGCATCTTTCCATACTTTAGG - Intergenic
1187597527 X:20789766-20789788 TATTCATCTTTGCATAAAATAGG - Intergenic
1187601310 X:20833786-20833808 TCTGCATCCTTGCAAACAGTTGG + Intergenic
1188641987 X:32517289-32517311 CATGCATCTTTGTATATGATTGG - Intronic
1189303625 X:39970457-39970479 CATGCTTGTTTGCATCCTGTTGG - Intergenic
1189670489 X:43403248-43403270 CATCTATATTTGCATACAATGGG + Intergenic
1191882018 X:65852073-65852095 CATGCTGCTTTGGTTACAGTAGG + Intergenic
1194464705 X:94219210-94219232 CTTGCAGGTTGGCATACAGTTGG - Intergenic
1196128761 X:112129260-112129282 CATACATTTTTTAATACAGTTGG + Intergenic
1197063164 X:122206750-122206772 CATGAAACATTGCATATAGTAGG + Intergenic
1197841230 X:130749095-130749117 TTTGCATATTTTCATACAGTTGG + Intronic
1199785605 X:151102405-151102427 CATGCCTCTTTGCCTTCTGTAGG - Intergenic
1201483368 Y:14465585-14465607 CCTGCATCTATGCATCCAGAAGG + Intergenic