ID: 1083183957

View in Genome Browser
Species Human (GRCh38)
Location 11:61007000-61007022
Sequence GTACAATCCTGGGCTAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083183948_1083183957 12 Left 1083183948 11:61006965-61006987 CCTACTGTATGCAAAGATGCATG 0: 1
1: 0
2: 2
3: 17
4: 164
Right 1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG 0: 1
1: 0
2: 0
3: 1
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083183957 Original CRISPR GTACAATCCTGGGCTAAAAG GGG Intronic
907255572 1:53176158-53176180 GTACAACCCTGTGCTAAGGGCGG + Intergenic
908191729 1:61710825-61710847 GTACTATTCTTGCCTAAAAGAGG - Intronic
908715723 1:67067659-67067681 GCACCAGCCTTGGCTAAAAGAGG + Intergenic
908964305 1:69739382-69739404 CTACATTCCTGGGCTTACAGGGG - Intronic
912405531 1:109434502-109434524 GTCCCATCTGGGGCTAAAAGGGG - Intergenic
915043257 1:152985973-152985995 GGACACTCCTGGGCTGGAAGTGG + Intergenic
916057835 1:161080220-161080242 ATACAATCCTAGGCTGCAAGAGG - Intronic
919428220 1:197460498-197460520 GCACAACCCTTGGCTGAAAGAGG - Intronic
1069626817 10:69873228-69873250 GTATAATCCATGTCTAAAAGGGG - Intronic
1074365349 10:112853399-112853421 GCAGAATCCAGGGCTCAAAGAGG - Intergenic
1077278894 11:1733082-1733104 GGACAAGCCTGGGCTGGAAGAGG - Exonic
1079543404 11:21603394-21603416 ATACAATGCTGGGAGAAAAGGGG + Intergenic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1088043013 11:105411572-105411594 GTACAGTCCTGGGCTCAGAATGG - Intergenic
1090241054 11:125182164-125182186 TTACAATCCTGGGCAAACTGGGG - Intronic
1091811872 12:3406182-3406204 GCTCCATCCTTGGCTAAAAGGGG - Intronic
1093458686 12:19388860-19388882 ATACACTCTTTGGCTAAAAGTGG - Intergenic
1098728998 12:74008900-74008922 CTACAATCCTGGGCTGAAGATGG + Intergenic
1101502540 12:105317453-105317475 GTCCATCCCTGGGCTTAAAGAGG + Intronic
1103160953 12:118728863-118728885 GTACAAACCAAGGCTCAAAGAGG - Intergenic
1107952923 13:45481071-45481093 CTACAATCATGAACTAAAAGGGG - Intronic
1110915001 13:81010418-81010440 GTACTATTCTAGGATAAAAGTGG + Intergenic
1112856328 13:103774145-103774167 CTAGAATCCTGGGCTCAAAAGGG - Intergenic
1112944368 13:104908836-104908858 GAACAATCCAGTGCTGAAAGTGG + Intergenic
1117589885 14:57256317-57256339 TTACAACCCTGGCCTAAAAAGGG + Intronic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1128960020 15:71992833-71992855 TTATAATCTTGGGCTAGAAGAGG + Intronic
1138926886 16:61603239-61603261 TTCGAAACCTGGGCTAAAAGAGG + Intergenic
1149085438 17:52710207-52710229 GCAGAATCCTGGGCTCACAGGGG + Intergenic
1150139085 17:62713618-62713640 TTACACTCCTGAGCTACAAGTGG + Intronic
1155413548 18:25571760-25571782 GTGCCATCCATGGCTAAAAGGGG - Intergenic
1159257115 18:65961128-65961150 GAACAATGCTGGGGTAAAGGAGG + Intergenic
1162079233 19:8208959-8208981 GGACAATACTGGGTTCAAAGGGG + Intronic
1164149966 19:22542251-22542273 GGACCATCCTGGGCAAAATGGGG - Intergenic
925247904 2:2401053-2401075 GTACAACCCTGGACCACAAGAGG - Intergenic
928348962 2:30529284-30529306 GCACATTTCTGTGCTAAAAGAGG + Intronic
928362249 2:30674647-30674669 TTACAATCCTGGGCTAACCTTGG - Intergenic
929101172 2:38315572-38315594 GTATACTCATGGCCTAAAAGTGG + Intronic
930158120 2:48126304-48126326 GTAGAATCCTAGGCAGAAAGGGG + Intergenic
930256763 2:49102135-49102157 GTATAATCCTGGACTATATGTGG - Intronic
931570263 2:63661477-63661499 GTACAATGCATGGCAAAAAGTGG + Intronic
936885731 2:117308652-117308674 GTACAGTTCTGGGCTCAATGGGG - Intergenic
937894432 2:126967888-126967910 GTTGAATACTGGGATAAAAGGGG - Intergenic
943895029 2:193347047-193347069 GTACAGTGGTGGGATAAAAGAGG + Intergenic
945589656 2:211714632-211714654 GTGCAATCCTGTGCTACAGGTGG - Intronic
1174892265 20:54408732-54408754 GTACATTCCTGAACCAAAAGTGG + Intergenic
1175256313 20:57649670-57649692 GTACAAACCTTGGCAAAAAAAGG + Exonic
1177279233 21:18957981-18958003 TAACAATCCTGAGCAAAAAGAGG + Intergenic
1179424889 21:41268113-41268135 GTACAGTCCTGGGCTAAGATCGG - Intronic
1181639007 22:24187187-24187209 GAACATTCCTGGGCTCAAGGGGG - Exonic
1182658307 22:31906893-31906915 GCACACTCCTGGGCAAGAAGTGG - Exonic
1182786726 22:32914172-32914194 ATACAAACCTGAGCTAACAGAGG + Intronic
952309231 3:32172481-32172503 GTAGAATCCTGGCTGAAAAGGGG - Intergenic
953607592 3:44421649-44421671 GCACACTCCTGGGCTGAAATGGG + Intergenic
959213799 3:103423864-103423886 GCAACATCCTGGGCTAAGAGGGG + Intergenic
971549825 4:27938880-27938902 AGACCATCCTGGGTTAAAAGTGG - Intergenic
974071416 4:57127595-57127617 GTCCCAGCCAGGGCTAAAAGGGG + Intergenic
975207716 4:71663692-71663714 GTACAATCAGGGCCTAGAAGTGG - Intergenic
975599444 4:76084017-76084039 GAATAACCCTGGGGTAAAAGAGG - Intronic
985698500 5:1356732-1356754 GTACAATCCTGGTGTATACGGGG + Intergenic
992950922 5:81857335-81857357 TTACAAGCATGGGCTAAATGGGG - Intergenic
993536072 5:89087907-89087929 GCATAATCCTGGCCTCAAAGTGG + Intergenic
993988237 5:94622938-94622960 GTACAACCCTTGGGAAAAAGCGG - Intronic
994200079 5:96963598-96963620 GTCCAATCCTAGGCTTTAAGAGG - Intronic
994978867 5:106846445-106846467 GGAAAAGCCTGGGGTAAAAGAGG + Intergenic
998213298 5:140218008-140218030 GTTCAATCATGGGAGAAAAGTGG + Intronic
999015388 5:148098196-148098218 GGACATTCCAGTGCTAAAAGAGG - Intronic
999993976 5:157074477-157074499 GTACAATGCTTGGCTTACAGTGG - Intergenic
1005030271 6:21501967-21501989 GTATAGTCCAAGGCTAAAAGCGG + Intergenic
1005783398 6:29217529-29217551 GCTCCATCCTTGGCTAAAAGAGG + Intergenic
1007230087 6:40342237-40342259 GTACAATTCTGGGCTTATGGTGG + Intergenic
1017936847 6:159013238-159013260 GAACAATGCTGGTCTTAAAGTGG - Intergenic
1018043270 6:159943761-159943783 GTACAGTCCTCAGCTGAAAGCGG - Intergenic
1019193888 6:170269895-170269917 TTACAAACCTAGGCTAAAACAGG - Intergenic
1020581541 7:10009070-10009092 GTACAATATAGGGCTAAGAGTGG - Intergenic
1033869013 7:145727256-145727278 ATACAATCCTGGGCAAATTGAGG - Intergenic
1039172852 8:34768085-34768107 ATACAATTCTGGGCTTTAAGTGG + Intergenic
1041346061 8:56899234-56899256 GTAATATCCTGGGATAAAATGGG - Intergenic
1052403517 9:28030779-28030801 GTACAATTAAGGGCAAAAAGTGG + Intronic
1055629216 9:78205947-78205969 GGACAATCCTATGCAAAAAGAGG + Intergenic
1056011537 9:82335990-82336012 GTTCTATCCTGTGTTAAAAGGGG + Intergenic
1058764883 9:108172456-108172478 AAATAATCCTGGGCAAAAAGTGG - Intergenic
1059570112 9:115425241-115425263 GTCCCAGCCTTGGCTAAAAGGGG - Intergenic
1185930447 X:4197042-4197064 ATACACTCCTGGGATAAATGTGG - Intergenic
1188896363 X:35673501-35673523 GTACAATCAGGGGCTCAAGGAGG - Intergenic
1195050105 X:101089097-101089119 GTAAAACCTTGGGCTGAAAGGGG - Intronic
1198811785 X:140543373-140543395 TCACCATCCTGGGCTAAAACTGG - Intergenic
1199065896 X:143417921-143417943 GTGCTATGCTGGGCTAAATGGGG - Intergenic
1199712583 X:150480795-150480817 ATATAGTCCTGGGCTAAAGGTGG + Intronic