ID: 1083184610

View in Genome Browser
Species Human (GRCh38)
Location 11:61009843-61009865
Sequence GGACCCTGGCTGCCAGCGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083184610 Original CRISPR GGACCCTGGCTGCCAGCGAC TGG (reversed) Exonic
900103958 1:974343-974365 GAACCCTGGCTGCCTCTGACAGG + Exonic
900574020 1:3374137-3374159 GGCCCCTGGCGGTCAGCGGCTGG - Intronic
901615238 1:10534284-10534306 TGACCCTGGGGGCCAGTGACTGG + Intronic
901643441 1:10704599-10704621 GGGCCCCGGCTGCGACCGACCGG - Intronic
902265199 1:15258250-15258272 AGACGGTGGCTGCCAGGGACTGG - Intronic
907272526 1:53299221-53299243 GGTCCCTGGCTGCTACCCACAGG + Intronic
907309994 1:53533743-53533765 GGACCTTGGCAGCCAGCTGCAGG - Intronic
910044795 1:82899424-82899446 GGACCCTGACTGACACTGACAGG + Intergenic
913378634 1:118184924-118184946 GGACCCAGGGTCCCAGGGACAGG - Intronic
922208372 1:223468586-223468608 GGACCCTGTCTGCCCTGGACTGG + Intergenic
922351427 1:224737424-224737446 GGACCCTGGGTGGCCGCCACGGG + Intronic
922950871 1:229558127-229558149 GGACCCTACCTGCCAGCCTCCGG + Exonic
1062807008 10:429412-429434 GGACCCTGGCTGCCTCCCCCCGG + Intronic
1062807018 10:429433-429455 GGACCCTGGCTGCCTCCCCCCGG + Intronic
1062807028 10:429454-429476 GGACCCTGGCTGCCTCCCCCCGG + Intronic
1062807038 10:429475-429497 GGACCCTGGCTGCCTCCCCCCGG + Intronic
1062807048 10:429496-429518 GGACCCTGGCTGCCTCCCCCCGG + Intronic
1066300871 10:34094437-34094459 GGACCATGGCTGAGAGGGACTGG - Intergenic
1066666321 10:37786006-37786028 GGACCTAGGCTGACAGCCACTGG - Intronic
1067077921 10:43198583-43198605 TGACCCTGTCTGCCAGCCTCTGG + Intronic
1067829853 10:49605307-49605329 GGACCCCTGCTGCCTGGGACTGG - Intergenic
1068338051 10:55664067-55664089 GGACAGTGGTTGCCAGGGACTGG + Intergenic
1074126112 10:110530196-110530218 TGACGCTGGCTCCCAGCGGCTGG + Intergenic
1076787872 10:132760006-132760028 GGACCCTGGCGGCCAGAGGCAGG + Intronic
1077026437 11:441967-441989 GGAGAGTGGCTGCCAGCGGCGGG + Exonic
1077040420 11:518750-518772 GGCCCCGGGCTGCCCACGACGGG + Intergenic
1078192132 11:9099849-9099871 GGACACAGGCTGCCTGCGAGAGG - Intronic
1079187244 11:18248629-18248651 GGTCCCTGTCTGCCAGGGAGAGG + Exonic
1079189557 11:18266248-18266270 GGTCCCTGCCTGCCAGGGAGCGG - Exonic
1080606522 11:33869257-33869279 GGACCCGGGCGGCCCGCGAGGGG - Intronic
1082010804 11:47448650-47448672 GGGCCCTGGCTGCCAGCCTGTGG + Intronic
1083035911 11:59637285-59637307 GGCCCCTGGCTGCCTGGGAACGG + Exonic
1083184610 11:61009843-61009865 GGACCCTGGCTGCCAGCGACTGG - Exonic
1083547444 11:63559422-63559444 GGACCCTGGATTCCTGGGACAGG - Intronic
1084505657 11:69565521-69565543 GATCACTGGCTGCCAGAGACTGG + Intergenic
1085725636 11:78952380-78952402 GGACCCGAGCTGCCAGCAGCGGG + Intronic
1088755104 11:112879052-112879074 GAAACCTGGCTGCCATGGACAGG + Intergenic
1089520260 11:119058451-119058473 AGACCCTGGCTGTCAGGGCCAGG + Intergenic
1090383078 11:126340201-126340223 GCACTCTGGCTGCCAGCCACAGG + Intronic
1090941336 11:131390723-131390745 GGTCCCTGGCTGGCAGCATCAGG + Intronic
1092893560 12:12992036-12992058 GGAACCTGGCTGCCCTAGACTGG + Intronic
1100565489 12:95790459-95790481 GGCCCCTGGCTCCCAGCTGCCGG - Exonic
1102551453 12:113695037-113695059 TGGCCCTGTCTGCCAGCGACAGG + Intergenic
1103947985 12:124537706-124537728 GGAGCTTGGCTGCCAGCCCCTGG - Intronic
1104980450 12:132571019-132571041 GGACCCTGGCTCCCGGGGAGGGG + Intronic
1108509171 13:51139359-51139381 GGATCATGGCTGCCAGGGGCTGG + Intergenic
1113717581 13:112523976-112523998 AGACCCTGGCAGCCATGGACAGG + Intronic
1118319810 14:64746570-64746592 GGACCCTGGCTCCCTCCGATAGG + Exonic
1119024429 14:71141337-71141359 GGACGGTGGCTGCCAGGGGCTGG - Intergenic
1119037030 14:71239158-71239180 GAATCATGGCTGCCAGGGACTGG + Intergenic
1121847083 14:97181121-97181143 GGAACCTGGCTCCCTGAGACAGG + Intergenic
1122087712 14:99318944-99318966 GGGCCCTGGCTGCCAGTTCCAGG - Intergenic
1122325969 14:100880837-100880859 GGGCCCTGGCTGCCTGCTCCCGG + Exonic
1122348186 14:101073225-101073247 GGGCCCAGGCTGCCAGCCCCAGG - Intergenic
1122978129 14:105179353-105179375 GGACGCTGGCTGCCACCCAGGGG - Intronic
1123696070 15:22880087-22880109 GGACCCAGGCTGCTAGGGCCCGG - Intronic
1123942878 15:25225061-25225083 GGAACCTGGCTGACAGACACTGG - Intergenic
1123944447 15:25232246-25232268 GGAACCTGGCTGACAGACACTGG - Intergenic
1124005643 15:25793597-25793619 GGGTCCTGGCTGCCAGGGAGCGG - Intronic
1127331184 15:57941728-57941750 GAACTCTGGCTGCTAGAGACAGG - Intergenic
1128143977 15:65322139-65322161 GGAGCCTGGCTGGCAGAGAAGGG - Intergenic
1132638925 16:968202-968224 AGAGGCCGGCTGCCAGCGACAGG - Intronic
1134178943 16:12032026-12032048 GAATGCTGGCTGCCAGGGACAGG - Intronic
1137562930 16:49514569-49514591 GGACCCTGCCTGGCAGAGCCCGG + Intronic
1138338960 16:56276003-56276025 GGACGATGGCTGCCAGGGACTGG - Exonic
1138458058 16:57132614-57132636 GGGGACTGGCTGCCAGCCACAGG - Intronic
1138542122 16:57694884-57694906 GGACCCTGTCTGGCAGGGAAAGG + Intronic
1139675508 16:68520550-68520572 GGACCCTGGCTGGAAGGGATGGG + Intergenic
1139776686 16:69320830-69320852 GCACCCGGGCTGCCAGCAGCAGG - Intronic
1140811736 16:78585330-78585352 TCACCCTGGCTGCCAGCCCCAGG + Intronic
1141670844 16:85491017-85491039 GTACCCTGGCGGCCAGAGGCAGG - Intergenic
1142201583 16:88763569-88763591 AGACCCTGGCTGGCAGCTCCAGG - Intronic
1142408789 16:89905709-89905731 GGCCCATGACTGCCAGCGGCTGG - Intronic
1142709098 17:1714076-1714098 GGACCCTGATGGCCAGCGAGTGG - Intergenic
1143526977 17:7478843-7478865 GACCCCTGGCTGCCAGCAAACGG + Intronic
1145910061 17:28537239-28537261 GGGCCCTGTCTGACAGAGACAGG + Exonic
1148229085 17:45920037-45920059 GGTACCTGGCTGCCATAGACAGG + Intronic
1151057400 17:71049256-71049278 TTACCCTGGTTGCCAGTGACAGG + Intergenic
1152415153 17:80155119-80155141 GGTCCCTGGCTTCCTGCAACAGG - Intergenic
1156499823 18:37550651-37550673 GGACCCAGGCAGCCAGCGGACGG - Intronic
1157311285 18:46555360-46555382 GGACCCTGGTTCCCAGCCATGGG + Intronic
1159036984 18:63286778-63286800 GGACCCTGCCTGGCAGAGATTGG - Intronic
1161068566 19:2249701-2249723 GGACCCTGGGGGGCAGCGCCTGG + Exonic
1162069656 19:8146137-8146159 GGACGCTGGCTCCCAGCTGCGGG - Exonic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
1163433746 19:17283044-17283066 AGACCCTGGATGTCAGGGACTGG - Intronic
1163664954 19:18598822-18598844 GGCCCCTGGCGTCCAGCGGCAGG + Exonic
1163696820 19:18768433-18768455 GGGCCCTGGTTGTCAGCGCCTGG - Intronic
1164498641 19:28793418-28793440 GGAGCCTGCCTGGCAGCGTCGGG - Intergenic
1165049751 19:33133922-33133944 GTCCTCTGGCTGCCAGCAACTGG + Intronic
1166718817 19:44985962-44985984 GGACCCTTCCGGCCACCGACAGG - Intronic
1168288121 19:55344522-55344544 GAACCCTGGTTGCCAGCTGCTGG + Intronic
925078223 2:1037516-1037538 GGTCCCTGGTGGCCAGGGACTGG - Intronic
925867751 2:8244024-8244046 GGACCCTGGCTGGCCCCGCCAGG + Intergenic
934656059 2:96117195-96117217 GGACCCGGGCTGCCGCTGACGGG - Intergenic
934975494 2:98799426-98799448 CGTCCCTGGCTGCCAGGGCCAGG - Intronic
936067107 2:109340605-109340627 GGACCCTGGGTGCCGGGGCCAGG - Intronic
936104031 2:109609486-109609508 GCAGCCTGGCTGCCAGGGGCTGG + Intronic
937325938 2:120989596-120989618 GGACACTGGCTGCCTGCCACTGG - Exonic
938104544 2:128521004-128521026 GGGACCTGGCTGCCGGAGACCGG + Intergenic
938528719 2:132162225-132162247 GGTCCCTGGCTGCAAGAGGCCGG - Intronic
940254269 2:151712752-151712774 GGACCCTCTCTACCAGCGAAGGG + Intronic
946114798 2:217451882-217451904 AGTCCCAGGCTGCCAGAGACTGG + Intronic
946177861 2:217932850-217932872 GGCCCCTAGATGGCAGCGACAGG + Intronic
946458835 2:219851567-219851589 TAACCCTGGCTGCCTGCGTCTGG + Intergenic
947978424 2:234387275-234387297 GGCTCCTGGCTGCCAGCCCCTGG + Intergenic
1168830906 20:844873-844895 GGTCCCTGGCTACCTGCTACGGG + Exonic
1169236090 20:3930961-3930983 GGACCTTATCTGCCAGGGACAGG + Intronic
1170881873 20:20304033-20304055 AGACCCTGGCTGCCTGCAAGGGG + Intronic
1171405633 20:24910673-24910695 GCACTCTGGCTGCCAGCCAGGGG - Intergenic
1172626066 20:36347581-36347603 GGACTCTGGCTACAAGTGACAGG + Intronic
1172978548 20:38924284-38924306 GGACCCTGGATACCAGCGCAGGG + Intergenic
1179544040 21:42102578-42102600 GGGCCCTGGCTTCCAGCTATGGG + Exonic
1179950238 21:44705019-44705041 GGTCCCTGACTTCCAGCAACAGG - Intronic
1180134636 21:45854427-45854449 GGATCCTGGGTGCCAGAGGCTGG - Intronic
1180170761 21:46057069-46057091 GGACCCTCCCTGCCCGTGACGGG + Intergenic
1180791673 22:18578269-18578291 GGACCCTGGCCCCCCCCGACAGG + Intergenic
1180947712 22:19705771-19705793 GGACCCTGCCTGCCTGGCACCGG + Intergenic
1180947732 22:19705842-19705864 GGACCCTGTCTGCCTGGCACTGG + Intergenic
1181230063 22:21417040-21417062 GGACCCTGGCCCCCCCCGACAGG - Intergenic
1181248586 22:21517826-21517848 GGACCCTGGCCCCCCCCGACAGG + Intergenic
1182753743 22:32661668-32661690 GGACCCTGCTTGACCGCGACAGG - Intronic
1183071564 22:35400061-35400083 GGAGCCTCGCGGCCAGCGATTGG - Exonic
1183478713 22:38051036-38051058 GGCCCCTGGCTACCATAGACAGG - Intergenic
1183602478 22:38848030-38848052 GGACCATGGCAGCCAGGGAGGGG - Intergenic
1183656126 22:39185697-39185719 GGCCTTTGGCTGCCAGCGGCCGG + Intergenic
1185277021 22:49954196-49954218 GGATCCTGGCAGCCACCGCCTGG - Intergenic
950140081 3:10609297-10609319 GAACTCTGGCTGCCAGCAGCAGG + Intronic
950493447 3:13319864-13319886 GGCCCTTGGCTGCCAGCCGCGGG + Exonic
950776616 3:15355834-15355856 GAGCCCTGGCTGCCCGCAACAGG + Intergenic
953911024 3:46893108-46893130 GGGCCCTGGCTGCCACCCACCGG - Intronic
954616233 3:51970008-51970030 GGCCCCTGGCTCCCAGCTCCCGG - Exonic
960921588 3:122752333-122752355 GGACCCTGCATGCCAGCATCAGG + Intronic
960971908 3:123145833-123145855 GGACCCTGGCTAACAGGAACAGG + Intronic
961479470 3:127170847-127170869 GGTCCCTGCCTGCCAGGGTCTGG + Intergenic
964720390 3:159763911-159763933 GGACCCGGGCTCCCAGCCGCGGG + Intronic
981754110 4:148122629-148122651 GGTCCCTGACTTCCAGCAACAGG - Intronic
984710564 4:182880766-182880788 GTACCATGGCTGCCTGTGACGGG + Intergenic
986000522 5:3627498-3627520 GGACCCTGCCTTCCTGCGGCGGG + Intergenic
993017663 5:82553792-82553814 GGACTGTTGCTGCCAGGGACAGG - Intergenic
997694654 5:135851637-135851659 GTACCCTGGCTGCCAGAGGCAGG - Intronic
998353955 5:141519022-141519044 AGACCCTGACTGACAGCCACAGG + Intronic
1002089517 5:176796222-176796244 GGACCCTGGCTGGCAGACAACGG + Intergenic
1002160846 5:177313128-177313150 GGAGCATTGCTGCCAGCCACGGG + Intergenic
1006933877 6:37704187-37704209 GGAGCCTGGCTTCCAGAGAGAGG - Intergenic
1007351084 6:41273919-41273941 GCTCCCTGGCTGCCAGCTTCTGG - Intronic
1010208967 6:73348284-73348306 GGATCCTAGCTGCCAGGGACAGG + Intergenic
1012582113 6:100881541-100881563 TTACCCTGGCTGCCCGCAACGGG + Intergenic
1013294605 6:108747434-108747456 GGGCCCTGACTGCCAGGGCCAGG - Intergenic
1015294526 6:131575505-131575527 GGTCCCTTGCTGCCAGGGACAGG + Intronic
1019341379 7:510548-510570 GGACCCTGGCTGCTAGGTAGGGG + Intronic
1019407007 7:889188-889210 GGGCCCTGGCTGCCTCCCACTGG + Intronic
1019512654 7:1425822-1425844 GGGCCCTGGATGTCAGCGAGGGG + Intergenic
1019716388 7:2541347-2541369 GGACCCTGGCGGGCTGCGTCCGG - Exonic
1020013792 7:4819837-4819859 GGGCCCTGGCTCCCATCGCCGGG + Intronic
1020153963 7:5706396-5706418 GAACCCTGGGTGCCAGAGGCTGG - Intronic
1022473265 7:30694574-30694596 GGGCCCAGGCTGCCAGGGACCGG + Intronic
1026544271 7:71308266-71308288 AGATCCTGGCTGCCAGTGCCGGG + Intronic
1029605723 7:101598474-101598496 AGATCCTGGCTGTCAGCGCCAGG - Intergenic
1029731192 7:102439272-102439294 CCATCCTGGCTGCCAGAGACTGG - Intronic
1034414802 7:150958750-150958772 GGACGCTGGCACCCAGCGGCCGG - Intronic
1036747987 8:11423783-11423805 AGACACTGGCTGCCAGCCACTGG + Exonic
1038401721 8:27289002-27289024 GGAACCTGCCTGCGAGGGACTGG + Intronic
1038426288 8:27466050-27466072 GGACCCTGGGTGCCAGCTATGGG + Intronic
1038553553 8:28490320-28490342 AGACCCCGGATGCCAGCGACGGG - Intergenic
1039474608 8:37833129-37833151 GTCCCCTGGCTCCCAGCGGCCGG - Exonic
1040058734 8:43086143-43086165 CGATCCTGGCTGCCAGCTCCAGG + Intergenic
1041321006 8:56612443-56612465 GGACCCTCCCTGCCAGAAACAGG - Intergenic
1044147329 8:88733300-88733322 GGCCCCTGGCTGACAGCACCTGG + Intergenic
1048269819 8:133019604-133019626 GGTGCCTGGCTGCCAGCAGCTGG - Exonic
1049091167 8:140514769-140514791 GGACCCTGCCTGCCACTGAAGGG + Intronic
1049432077 8:142569823-142569845 GCTCCCTGGCTGCCGGCCACAGG + Intergenic
1049690562 8:143957119-143957141 GGTCCCAGGCTGGCAGCGAAGGG + Intronic
1049826564 8:144672542-144672564 GCACCCTGGCTGCCAGGAGCTGG + Intergenic
1050125699 9:2354373-2354395 GGACCCTGGCTTCCGGCCTCAGG + Intergenic
1054734778 9:68739871-68739893 GCACGCTGTCTGCCAGCCACAGG + Intronic
1055264611 9:74480705-74480727 GGCCCCTGGCAGCCAGGAACTGG - Intergenic
1057140769 9:92725632-92725654 GGACCCTGGTGGTCAGCTACAGG - Intronic
1057832272 9:98416549-98416571 GGACCCTGCCTGACAGGAACAGG - Intronic
1060223040 9:121774421-121774443 GGACCCTGGCGGCTCGGGACAGG + Intronic
1061726872 9:132586967-132586989 GGACCCAGCCTGCCAGCGTAGGG - Intronic
1062220526 9:135412778-135412800 GGACCCTGGCACCCAGCGGGCGG + Intergenic
1186611644 X:11143771-11143793 GGACCCTCCCAGCCAACGACTGG + Intronic
1186884953 X:13903787-13903809 CCACCCTGGCTGCCAGACACAGG - Intronic
1187932878 X:24310265-24310287 GAACAATGGCTGCCAGGGACTGG + Intergenic
1187939335 X:24366006-24366028 GAACAATGGCTGCCAGGGACTGG - Intergenic
1197776370 X:130121050-130121072 GGGCGCTGGCTGCCTGCGCCGGG - Intergenic
1198617824 X:138478489-138478511 GGTCCCTGGCTGTCAGGAACAGG + Intergenic
1200099943 X:153685361-153685383 TGACCCGGGCGGCCAGTGACAGG - Intronic
1200115516 X:153768166-153768188 GTACCCAGGCTGCCAGCGGGAGG - Intronic
1202074952 Y:21028172-21028194 GGACCCTGGGTGCAAGGGTCAGG + Intergenic
1202201243 Y:22351820-22351842 AGACACTGGGTGCCAGCGAAAGG - Intronic