ID: 1083187361

View in Genome Browser
Species Human (GRCh38)
Location 11:61025547-61025569
Sequence TCACCGTCATATTGTCATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083187361_1083187366 29 Left 1083187361 11:61025547-61025569 CCATGATGACAATATGACGGTGA No data
Right 1083187366 11:61025599-61025621 ACACTCAGAACCTGTGTGTCGGG No data
1083187361_1083187363 5 Left 1083187361 11:61025547-61025569 CCATGATGACAATATGACGGTGA No data
Right 1083187363 11:61025575-61025597 ATGATAGCTTCGATTCCTGAGGG No data
1083187361_1083187362 4 Left 1083187361 11:61025547-61025569 CCATGATGACAATATGACGGTGA No data
Right 1083187362 11:61025574-61025596 AATGATAGCTTCGATTCCTGAGG No data
1083187361_1083187365 28 Left 1083187361 11:61025547-61025569 CCATGATGACAATATGACGGTGA No data
Right 1083187365 11:61025598-61025620 CACACTCAGAACCTGTGTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083187361 Original CRISPR TCACCGTCATATTGTCATCA TGG (reversed) Intergenic