ID: 1083187362

View in Genome Browser
Species Human (GRCh38)
Location 11:61025574-61025596
Sequence AATGATAGCTTCGATTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083187361_1083187362 4 Left 1083187361 11:61025547-61025569 CCATGATGACAATATGACGGTGA No data
Right 1083187362 11:61025574-61025596 AATGATAGCTTCGATTCCTGAGG No data
1083187359_1083187362 8 Left 1083187359 11:61025543-61025565 CCAGCCATGATGACAATATGACG No data
Right 1083187362 11:61025574-61025596 AATGATAGCTTCGATTCCTGAGG No data
1083187357_1083187362 23 Left 1083187357 11:61025528-61025550 CCAACACAGCAGCCTCCAGCCAT No data
Right 1083187362 11:61025574-61025596 AATGATAGCTTCGATTCCTGAGG No data
1083187358_1083187362 11 Left 1083187358 11:61025540-61025562 CCTCCAGCCATGATGACAATATG No data
Right 1083187362 11:61025574-61025596 AATGATAGCTTCGATTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083187362 Original CRISPR AATGATAGCTTCGATTCCTG AGG Intergenic