ID: 1083187363

View in Genome Browser
Species Human (GRCh38)
Location 11:61025575-61025597
Sequence ATGATAGCTTCGATTCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083187357_1083187363 24 Left 1083187357 11:61025528-61025550 CCAACACAGCAGCCTCCAGCCAT No data
Right 1083187363 11:61025575-61025597 ATGATAGCTTCGATTCCTGAGGG No data
1083187361_1083187363 5 Left 1083187361 11:61025547-61025569 CCATGATGACAATATGACGGTGA No data
Right 1083187363 11:61025575-61025597 ATGATAGCTTCGATTCCTGAGGG No data
1083187358_1083187363 12 Left 1083187358 11:61025540-61025562 CCTCCAGCCATGATGACAATATG No data
Right 1083187363 11:61025575-61025597 ATGATAGCTTCGATTCCTGAGGG No data
1083187359_1083187363 9 Left 1083187359 11:61025543-61025565 CCAGCCATGATGACAATATGACG No data
Right 1083187363 11:61025575-61025597 ATGATAGCTTCGATTCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083187363 Original CRISPR ATGATAGCTTCGATTCCTGA GGG Intergenic