ID: 1083187366

View in Genome Browser
Species Human (GRCh38)
Location 11:61025599-61025621
Sequence ACACTCAGAACCTGTGTGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083187361_1083187366 29 Left 1083187361 11:61025547-61025569 CCATGATGACAATATGACGGTGA No data
Right 1083187366 11:61025599-61025621 ACACTCAGAACCTGTGTGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083187366 Original CRISPR ACACTCAGAACCTGTGTGTC GGG Intergenic