ID: 1083189078

View in Genome Browser
Species Human (GRCh38)
Location 11:61036517-61036539
Sequence GGGGGAGAGCTGGGCATTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083189078_1083189090 17 Left 1083189078 11:61036517-61036539 CCTTGAATGCCCAGCTCTCCCCC No data
Right 1083189090 11:61036557-61036579 CACAGCCCATTGGAGTGGGTTGG No data
1083189078_1083189086 7 Left 1083189078 11:61036517-61036539 CCTTGAATGCCCAGCTCTCCCCC No data
Right 1083189086 11:61036547-61036569 GACCACACTGCACAGCCCATTGG 0: 1
1: 0
2: 1
3: 17
4: 317
1083189078_1083189093 20 Left 1083189078 11:61036517-61036539 CCTTGAATGCCCAGCTCTCCCCC No data
Right 1083189093 11:61036560-61036582 AGCCCATTGGAGTGGGTTGGGGG No data
1083189078_1083189091 18 Left 1083189078 11:61036517-61036539 CCTTGAATGCCCAGCTCTCCCCC No data
Right 1083189091 11:61036558-61036580 ACAGCCCATTGGAGTGGGTTGGG No data
1083189078_1083189092 19 Left 1083189078 11:61036517-61036539 CCTTGAATGCCCAGCTCTCCCCC No data
Right 1083189092 11:61036559-61036581 CAGCCCATTGGAGTGGGTTGGGG No data
1083189078_1083189088 12 Left 1083189078 11:61036517-61036539 CCTTGAATGCCCAGCTCTCCCCC No data
Right 1083189088 11:61036552-61036574 CACTGCACAGCCCATTGGAGTGG No data
1083189078_1083189089 13 Left 1083189078 11:61036517-61036539 CCTTGAATGCCCAGCTCTCCCCC No data
Right 1083189089 11:61036553-61036575 ACTGCACAGCCCATTGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083189078 Original CRISPR GGGGGAGAGCTGGGCATTCA AGG (reversed) Intergenic