ID: 1083189081

View in Genome Browser
Species Human (GRCh38)
Location 11:61036527-61036549
Sequence GTCTTTGCCAGGGGGAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083189081_1083189086 -3 Left 1083189081 11:61036527-61036549 CCAGCTCTCCCCCTGGCAAAGAC No data
Right 1083189086 11:61036547-61036569 GACCACACTGCACAGCCCATTGG 0: 1
1: 0
2: 1
3: 17
4: 317
1083189081_1083189092 9 Left 1083189081 11:61036527-61036549 CCAGCTCTCCCCCTGGCAAAGAC No data
Right 1083189092 11:61036559-61036581 CAGCCCATTGGAGTGGGTTGGGG No data
1083189081_1083189091 8 Left 1083189081 11:61036527-61036549 CCAGCTCTCCCCCTGGCAAAGAC No data
Right 1083189091 11:61036558-61036580 ACAGCCCATTGGAGTGGGTTGGG No data
1083189081_1083189090 7 Left 1083189081 11:61036527-61036549 CCAGCTCTCCCCCTGGCAAAGAC No data
Right 1083189090 11:61036557-61036579 CACAGCCCATTGGAGTGGGTTGG No data
1083189081_1083189088 2 Left 1083189081 11:61036527-61036549 CCAGCTCTCCCCCTGGCAAAGAC No data
Right 1083189088 11:61036552-61036574 CACTGCACAGCCCATTGGAGTGG No data
1083189081_1083189093 10 Left 1083189081 11:61036527-61036549 CCAGCTCTCCCCCTGGCAAAGAC No data
Right 1083189093 11:61036560-61036582 AGCCCATTGGAGTGGGTTGGGGG No data
1083189081_1083189089 3 Left 1083189081 11:61036527-61036549 CCAGCTCTCCCCCTGGCAAAGAC No data
Right 1083189089 11:61036553-61036575 ACTGCACAGCCCATTGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083189081 Original CRISPR GTCTTTGCCAGGGGGAGAGC TGG (reversed) Intergenic