ID: 1083189082

View in Genome Browser
Species Human (GRCh38)
Location 11:61036535-61036557
Sequence GCAGTGTGGTCTTTGCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083189082_1083189093 2 Left 1083189082 11:61036535-61036557 CCCCCTGGCAAAGACCACACTGC No data
Right 1083189093 11:61036560-61036582 AGCCCATTGGAGTGGGTTGGGGG No data
1083189082_1083189088 -6 Left 1083189082 11:61036535-61036557 CCCCCTGGCAAAGACCACACTGC No data
Right 1083189088 11:61036552-61036574 CACTGCACAGCCCATTGGAGTGG No data
1083189082_1083189089 -5 Left 1083189082 11:61036535-61036557 CCCCCTGGCAAAGACCACACTGC No data
Right 1083189089 11:61036553-61036575 ACTGCACAGCCCATTGGAGTGGG No data
1083189082_1083189091 0 Left 1083189082 11:61036535-61036557 CCCCCTGGCAAAGACCACACTGC No data
Right 1083189091 11:61036558-61036580 ACAGCCCATTGGAGTGGGTTGGG No data
1083189082_1083189090 -1 Left 1083189082 11:61036535-61036557 CCCCCTGGCAAAGACCACACTGC No data
Right 1083189090 11:61036557-61036579 CACAGCCCATTGGAGTGGGTTGG No data
1083189082_1083189092 1 Left 1083189082 11:61036535-61036557 CCCCCTGGCAAAGACCACACTGC No data
Right 1083189092 11:61036559-61036581 CAGCCCATTGGAGTGGGTTGGGG No data
1083189082_1083189096 24 Left 1083189082 11:61036535-61036557 CCCCCTGGCAAAGACCACACTGC No data
Right 1083189096 11:61036582-61036604 GTGCTGCATAGTGTCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083189082 Original CRISPR GCAGTGTGGTCTTTGCCAGG GGG (reversed) Intergenic