ID: 1083189086

View in Genome Browser
Species Human (GRCh38)
Location 11:61036547-61036569
Sequence GACCACACTGCACAGCCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083189081_1083189086 -3 Left 1083189081 11:61036527-61036549 CCAGCTCTCCCCCTGGCAAAGAC No data
Right 1083189086 11:61036547-61036569 GACCACACTGCACAGCCCATTGG No data
1083189078_1083189086 7 Left 1083189078 11:61036517-61036539 CCTTGAATGCCCAGCTCTCCCCC No data
Right 1083189086 11:61036547-61036569 GACCACACTGCACAGCCCATTGG No data
1083189077_1083189086 26 Left 1083189077 11:61036498-61036520 CCAACTATGCTGGGGGAGACCTT No data
Right 1083189086 11:61036547-61036569 GACCACACTGCACAGCCCATTGG No data
1083189080_1083189086 -2 Left 1083189080 11:61036526-61036548 CCCAGCTCTCCCCCTGGCAAAGA No data
Right 1083189086 11:61036547-61036569 GACCACACTGCACAGCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083189086 Original CRISPR GACCACACTGCACAGCCCAT TGG Intergenic