ID: 1083189087

View in Genome Browser
Species Human (GRCh38)
Location 11:61036549-61036571
Sequence CTCCAATGGGCTGTGCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083189087_1083189101 27 Left 1083189087 11:61036549-61036571 CCACACTGCACAGCCCATTGGAG No data
Right 1083189101 11:61036599-61036621 CCCAGGCATCTGGAGTGCCAGGG No data
1083189087_1083189097 17 Left 1083189087 11:61036549-61036571 CCACACTGCACAGCCCATTGGAG No data
Right 1083189097 11:61036589-61036611 ATAGTGTCCTCCCAGGCATCTGG No data
1083189087_1083189096 10 Left 1083189087 11:61036549-61036571 CCACACTGCACAGCCCATTGGAG No data
Right 1083189096 11:61036582-61036604 GTGCTGCATAGTGTCCTCCCAGG No data
1083189087_1083189099 26 Left 1083189087 11:61036549-61036571 CCACACTGCACAGCCCATTGGAG No data
Right 1083189099 11:61036598-61036620 TCCCAGGCATCTGGAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083189087 Original CRISPR CTCCAATGGGCTGTGCAGTG TGG (reversed) Intergenic