ID: 1083189090

View in Genome Browser
Species Human (GRCh38)
Location 11:61036557-61036579
Sequence CACAGCCCATTGGAGTGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083189078_1083189090 17 Left 1083189078 11:61036517-61036539 CCTTGAATGCCCAGCTCTCCCCC No data
Right 1083189090 11:61036557-61036579 CACAGCCCATTGGAGTGGGTTGG No data
1083189084_1083189090 -3 Left 1083189084 11:61036537-61036559 CCCTGGCAAAGACCACACTGCAC No data
Right 1083189090 11:61036557-61036579 CACAGCCCATTGGAGTGGGTTGG No data
1083189083_1083189090 -2 Left 1083189083 11:61036536-61036558 CCCCTGGCAAAGACCACACTGCA No data
Right 1083189090 11:61036557-61036579 CACAGCCCATTGGAGTGGGTTGG No data
1083189080_1083189090 8 Left 1083189080 11:61036526-61036548 CCCAGCTCTCCCCCTGGCAAAGA No data
Right 1083189090 11:61036557-61036579 CACAGCCCATTGGAGTGGGTTGG No data
1083189081_1083189090 7 Left 1083189081 11:61036527-61036549 CCAGCTCTCCCCCTGGCAAAGAC No data
Right 1083189090 11:61036557-61036579 CACAGCCCATTGGAGTGGGTTGG No data
1083189085_1083189090 -4 Left 1083189085 11:61036538-61036560 CCTGGCAAAGACCACACTGCACA No data
Right 1083189090 11:61036557-61036579 CACAGCCCATTGGAGTGGGTTGG No data
1083189082_1083189090 -1 Left 1083189082 11:61036535-61036557 CCCCCTGGCAAAGACCACACTGC No data
Right 1083189090 11:61036557-61036579 CACAGCCCATTGGAGTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083189090 Original CRISPR CACAGCCCATTGGAGTGGGT TGG Intergenic