ID: 1083189094

View in Genome Browser
Species Human (GRCh38)
Location 11:61036562-61036584
Sequence CACCCCCAACCCACTCCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083189094_1083189096 -3 Left 1083189094 11:61036562-61036584 CCCATTGGAGTGGGTTGGGGGTG No data
Right 1083189096 11:61036582-61036604 GTGCTGCATAGTGTCCTCCCAGG No data
1083189094_1083189101 14 Left 1083189094 11:61036562-61036584 CCCATTGGAGTGGGTTGGGGGTG No data
Right 1083189101 11:61036599-61036621 CCCAGGCATCTGGAGTGCCAGGG No data
1083189094_1083189099 13 Left 1083189094 11:61036562-61036584 CCCATTGGAGTGGGTTGGGGGTG No data
Right 1083189099 11:61036598-61036620 TCCCAGGCATCTGGAGTGCCAGG No data
1083189094_1083189103 22 Left 1083189094 11:61036562-61036584 CCCATTGGAGTGGGTTGGGGGTG No data
Right 1083189103 11:61036607-61036629 TCTGGAGTGCCAGGGCCTGCAGG No data
1083189094_1083189097 4 Left 1083189094 11:61036562-61036584 CCCATTGGAGTGGGTTGGGGGTG No data
Right 1083189097 11:61036589-61036611 ATAGTGTCCTCCCAGGCATCTGG No data
1083189094_1083189104 27 Left 1083189094 11:61036562-61036584 CCCATTGGAGTGGGTTGGGGGTG No data
Right 1083189104 11:61036612-61036634 AGTGCCAGGGCCTGCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083189094 Original CRISPR CACCCCCAACCCACTCCAAT GGG (reversed) Intergenic