ID: 1083189095

View in Genome Browser
Species Human (GRCh38)
Location 11:61036563-61036585
Sequence GCACCCCCAACCCACTCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083189095_1083189097 3 Left 1083189095 11:61036563-61036585 CCATTGGAGTGGGTTGGGGGTGC No data
Right 1083189097 11:61036589-61036611 ATAGTGTCCTCCCAGGCATCTGG No data
1083189095_1083189101 13 Left 1083189095 11:61036563-61036585 CCATTGGAGTGGGTTGGGGGTGC No data
Right 1083189101 11:61036599-61036621 CCCAGGCATCTGGAGTGCCAGGG No data
1083189095_1083189096 -4 Left 1083189095 11:61036563-61036585 CCATTGGAGTGGGTTGGGGGTGC No data
Right 1083189096 11:61036582-61036604 GTGCTGCATAGTGTCCTCCCAGG No data
1083189095_1083189104 26 Left 1083189095 11:61036563-61036585 CCATTGGAGTGGGTTGGGGGTGC No data
Right 1083189104 11:61036612-61036634 AGTGCCAGGGCCTGCAGGTGTGG No data
1083189095_1083189103 21 Left 1083189095 11:61036563-61036585 CCATTGGAGTGGGTTGGGGGTGC No data
Right 1083189103 11:61036607-61036629 TCTGGAGTGCCAGGGCCTGCAGG No data
1083189095_1083189099 12 Left 1083189095 11:61036563-61036585 CCATTGGAGTGGGTTGGGGGTGC No data
Right 1083189099 11:61036598-61036620 TCCCAGGCATCTGGAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083189095 Original CRISPR GCACCCCCAACCCACTCCAA TGG (reversed) Intergenic