ID: 1083189097

View in Genome Browser
Species Human (GRCh38)
Location 11:61036589-61036611
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083189095_1083189097 3 Left 1083189095 11:61036563-61036585 CCATTGGAGTGGGTTGGGGGTGC No data
Right 1083189097 11:61036589-61036611 ATAGTGTCCTCCCAGGCATCTGG No data
1083189087_1083189097 17 Left 1083189087 11:61036549-61036571 CCACACTGCACAGCCCATTGGAG No data
Right 1083189097 11:61036589-61036611 ATAGTGTCCTCCCAGGCATCTGG No data
1083189094_1083189097 4 Left 1083189094 11:61036562-61036584 CCCATTGGAGTGGGTTGGGGGTG No data
Right 1083189097 11:61036589-61036611 ATAGTGTCCTCCCAGGCATCTGG No data
1083189083_1083189097 30 Left 1083189083 11:61036536-61036558 CCCCTGGCAAAGACCACACTGCA No data
Right 1083189097 11:61036589-61036611 ATAGTGTCCTCCCAGGCATCTGG No data
1083189084_1083189097 29 Left 1083189084 11:61036537-61036559 CCCTGGCAAAGACCACACTGCAC No data
Right 1083189097 11:61036589-61036611 ATAGTGTCCTCCCAGGCATCTGG No data
1083189085_1083189097 28 Left 1083189085 11:61036538-61036560 CCTGGCAAAGACCACACTGCACA No data
Right 1083189097 11:61036589-61036611 ATAGTGTCCTCCCAGGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083189097 Original CRISPR ATAGTGTCCTCCCAGGCATC TGG Intergenic