ID: 1083189099

View in Genome Browser
Species Human (GRCh38)
Location 11:61036598-61036620
Sequence TCCCAGGCATCTGGAGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083189094_1083189099 13 Left 1083189094 11:61036562-61036584 CCCATTGGAGTGGGTTGGGGGTG No data
Right 1083189099 11:61036598-61036620 TCCCAGGCATCTGGAGTGCCAGG No data
1083189087_1083189099 26 Left 1083189087 11:61036549-61036571 CCACACTGCACAGCCCATTGGAG No data
Right 1083189099 11:61036598-61036620 TCCCAGGCATCTGGAGTGCCAGG No data
1083189095_1083189099 12 Left 1083189095 11:61036563-61036585 CCATTGGAGTGGGTTGGGGGTGC No data
Right 1083189099 11:61036598-61036620 TCCCAGGCATCTGGAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083189099 Original CRISPR TCCCAGGCATCTGGAGTGCC AGG Intergenic