ID: 1083189103

View in Genome Browser
Species Human (GRCh38)
Location 11:61036607-61036629
Sequence TCTGGAGTGCCAGGGCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083189094_1083189103 22 Left 1083189094 11:61036562-61036584 CCCATTGGAGTGGGTTGGGGGTG No data
Right 1083189103 11:61036607-61036629 TCTGGAGTGCCAGGGCCTGCAGG No data
1083189095_1083189103 21 Left 1083189095 11:61036563-61036585 CCATTGGAGTGGGTTGGGGGTGC No data
Right 1083189103 11:61036607-61036629 TCTGGAGTGCCAGGGCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083189103 Original CRISPR TCTGGAGTGCCAGGGCCTGC AGG Intergenic