ID: 1083189104

View in Genome Browser
Species Human (GRCh38)
Location 11:61036612-61036634
Sequence AGTGCCAGGGCCTGCAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083189100_1083189104 -10 Left 1083189100 11:61036599-61036621 CCCAGGCATCTGGAGTGCCAGGG No data
Right 1083189104 11:61036612-61036634 AGTGCCAGGGCCTGCAGGTGTGG No data
1083189094_1083189104 27 Left 1083189094 11:61036562-61036584 CCCATTGGAGTGGGTTGGGGGTG No data
Right 1083189104 11:61036612-61036634 AGTGCCAGGGCCTGCAGGTGTGG No data
1083189098_1083189104 -7 Left 1083189098 11:61036596-61036618 CCTCCCAGGCATCTGGAGTGCCA No data
Right 1083189104 11:61036612-61036634 AGTGCCAGGGCCTGCAGGTGTGG No data
1083189095_1083189104 26 Left 1083189095 11:61036563-61036585 CCATTGGAGTGGGTTGGGGGTGC No data
Right 1083189104 11:61036612-61036634 AGTGCCAGGGCCTGCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083189104 Original CRISPR AGTGCCAGGGCCTGCAGGTG TGG Intergenic