ID: 1083190981

View in Genome Browser
Species Human (GRCh38)
Location 11:61052386-61052408
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083190981_1083190984 -5 Left 1083190981 11:61052386-61052408 CCTGGGCTCTAATCCCAGGGAGC No data
Right 1083190984 11:61052404-61052426 GGAGCTTTCCCTTCTCTTTCAGG No data
1083190981_1083190990 29 Left 1083190981 11:61052386-61052408 CCTGGGCTCTAATCCCAGGGAGC No data
Right 1083190990 11:61052438-61052460 TACTTAGCAGGTACGAGGGCAGG No data
1083190981_1083190988 24 Left 1083190981 11:61052386-61052408 CCTGGGCTCTAATCCCAGGGAGC No data
Right 1083190988 11:61052433-61052455 AAACATACTTAGCAGGTACGAGG No data
1083190981_1083190987 17 Left 1083190981 11:61052386-61052408 CCTGGGCTCTAATCCCAGGGAGC No data
Right 1083190987 11:61052426-61052448 GCAGTTGAAACATACTTAGCAGG No data
1083190981_1083190989 25 Left 1083190981 11:61052386-61052408 CCTGGGCTCTAATCCCAGGGAGC No data
Right 1083190989 11:61052434-61052456 AACATACTTAGCAGGTACGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083190981 Original CRISPR GCTCCCTGGGATTAGAGCCC AGG (reversed) Intergenic
No off target data available for this crispr