ID: 1083190982

View in Genome Browser
Species Human (GRCh38)
Location 11:61052399-61052421
Sequence AAGAGAAGGGAAAGCTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083190982_1083190987 4 Left 1083190982 11:61052399-61052421 CCCAGGGAGCTTTCCCTTCTCTT No data
Right 1083190987 11:61052426-61052448 GCAGTTGAAACATACTTAGCAGG No data
1083190982_1083190989 12 Left 1083190982 11:61052399-61052421 CCCAGGGAGCTTTCCCTTCTCTT No data
Right 1083190989 11:61052434-61052456 AACATACTTAGCAGGTACGAGGG No data
1083190982_1083190990 16 Left 1083190982 11:61052399-61052421 CCCAGGGAGCTTTCCCTTCTCTT No data
Right 1083190990 11:61052438-61052460 TACTTAGCAGGTACGAGGGCAGG No data
1083190982_1083190988 11 Left 1083190982 11:61052399-61052421 CCCAGGGAGCTTTCCCTTCTCTT No data
Right 1083190988 11:61052433-61052455 AAACATACTTAGCAGGTACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083190982 Original CRISPR AAGAGAAGGGAAAGCTCCCT GGG (reversed) Intergenic
No off target data available for this crispr