ID: 1083190984

View in Genome Browser
Species Human (GRCh38)
Location 11:61052404-61052426
Sequence GGAGCTTTCCCTTCTCTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083190978_1083190984 2 Left 1083190978 11:61052379-61052401 CCTGGAGCCTGGGCTCTAATCCC No data
Right 1083190984 11:61052404-61052426 GGAGCTTTCCCTTCTCTTTCAGG No data
1083190981_1083190984 -5 Left 1083190981 11:61052386-61052408 CCTGGGCTCTAATCCCAGGGAGC No data
Right 1083190984 11:61052404-61052426 GGAGCTTTCCCTTCTCTTTCAGG No data
1083190977_1083190984 3 Left 1083190977 11:61052378-61052400 CCCTGGAGCCTGGGCTCTAATCC No data
Right 1083190984 11:61052404-61052426 GGAGCTTTCCCTTCTCTTTCAGG No data
1083190976_1083190984 9 Left 1083190976 11:61052372-61052394 CCGGATCCCTGGAGCCTGGGCTC No data
Right 1083190984 11:61052404-61052426 GGAGCTTTCCCTTCTCTTTCAGG No data
1083190974_1083190984 12 Left 1083190974 11:61052369-61052391 CCACCGGATCCCTGGAGCCTGGG No data
Right 1083190984 11:61052404-61052426 GGAGCTTTCCCTTCTCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083190984 Original CRISPR GGAGCTTTCCCTTCTCTTTC AGG Intergenic
No off target data available for this crispr