ID: 1083190986

View in Genome Browser
Species Human (GRCh38)
Location 11:61052413-61052435
Sequence TTTCAACTGCCTGAAAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083190986_1083190989 -2 Left 1083190986 11:61052413-61052435 CCTTCTCTTTCAGGCAGTTGAAA No data
Right 1083190989 11:61052434-61052456 AACATACTTAGCAGGTACGAGGG No data
1083190986_1083190993 28 Left 1083190986 11:61052413-61052435 CCTTCTCTTTCAGGCAGTTGAAA No data
Right 1083190993 11:61052464-61052486 CCCACCCCATTCCACAGGTTTGG No data
1083190986_1083190988 -3 Left 1083190986 11:61052413-61052435 CCTTCTCTTTCAGGCAGTTGAAA No data
Right 1083190988 11:61052433-61052455 AAACATACTTAGCAGGTACGAGG No data
1083190986_1083190990 2 Left 1083190986 11:61052413-61052435 CCTTCTCTTTCAGGCAGTTGAAA No data
Right 1083190990 11:61052438-61052460 TACTTAGCAGGTACGAGGGCAGG No data
1083190986_1083190987 -10 Left 1083190986 11:61052413-61052435 CCTTCTCTTTCAGGCAGTTGAAA No data
Right 1083190987 11:61052426-61052448 GCAGTTGAAACATACTTAGCAGG No data
1083190986_1083190991 23 Left 1083190986 11:61052413-61052435 CCTTCTCTTTCAGGCAGTTGAAA No data
Right 1083190991 11:61052459-61052481 GGTGTCCCACCCCATTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083190986 Original CRISPR TTTCAACTGCCTGAAAGAGA AGG (reversed) Intergenic
No off target data available for this crispr