ID: 1083190987

View in Genome Browser
Species Human (GRCh38)
Location 11:61052426-61052448
Sequence GCAGTTGAAACATACTTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083190977_1083190987 25 Left 1083190977 11:61052378-61052400 CCCTGGAGCCTGGGCTCTAATCC No data
Right 1083190987 11:61052426-61052448 GCAGTTGAAACATACTTAGCAGG No data
1083190982_1083190987 4 Left 1083190982 11:61052399-61052421 CCCAGGGAGCTTTCCCTTCTCTT No data
Right 1083190987 11:61052426-61052448 GCAGTTGAAACATACTTAGCAGG No data
1083190986_1083190987 -10 Left 1083190986 11:61052413-61052435 CCTTCTCTTTCAGGCAGTTGAAA No data
Right 1083190987 11:61052426-61052448 GCAGTTGAAACATACTTAGCAGG No data
1083190983_1083190987 3 Left 1083190983 11:61052400-61052422 CCAGGGAGCTTTCCCTTCTCTTT No data
Right 1083190987 11:61052426-61052448 GCAGTTGAAACATACTTAGCAGG No data
1083190978_1083190987 24 Left 1083190978 11:61052379-61052401 CCTGGAGCCTGGGCTCTAATCCC No data
Right 1083190987 11:61052426-61052448 GCAGTTGAAACATACTTAGCAGG No data
1083190981_1083190987 17 Left 1083190981 11:61052386-61052408 CCTGGGCTCTAATCCCAGGGAGC No data
Right 1083190987 11:61052426-61052448 GCAGTTGAAACATACTTAGCAGG No data
1083190985_1083190987 -9 Left 1083190985 11:61052412-61052434 CCCTTCTCTTTCAGGCAGTTGAA No data
Right 1083190987 11:61052426-61052448 GCAGTTGAAACATACTTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083190987 Original CRISPR GCAGTTGAAACATACTTAGC AGG Intergenic
No off target data available for this crispr