ID: 1083190988

View in Genome Browser
Species Human (GRCh38)
Location 11:61052433-61052455
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083190986_1083190988 -3 Left 1083190986 11:61052413-61052435 CCTTCTCTTTCAGGCAGTTGAAA No data
Right 1083190988 11:61052433-61052455 AAACATACTTAGCAGGTACGAGG No data
1083190983_1083190988 10 Left 1083190983 11:61052400-61052422 CCAGGGAGCTTTCCCTTCTCTTT No data
Right 1083190988 11:61052433-61052455 AAACATACTTAGCAGGTACGAGG No data
1083190985_1083190988 -2 Left 1083190985 11:61052412-61052434 CCCTTCTCTTTCAGGCAGTTGAA No data
Right 1083190988 11:61052433-61052455 AAACATACTTAGCAGGTACGAGG No data
1083190982_1083190988 11 Left 1083190982 11:61052399-61052421 CCCAGGGAGCTTTCCCTTCTCTT No data
Right 1083190988 11:61052433-61052455 AAACATACTTAGCAGGTACGAGG No data
1083190981_1083190988 24 Left 1083190981 11:61052386-61052408 CCTGGGCTCTAATCCCAGGGAGC No data
Right 1083190988 11:61052433-61052455 AAACATACTTAGCAGGTACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083190988 Original CRISPR AAACATACTTAGCAGGTACG AGG Intergenic
No off target data available for this crispr