ID: 1083199269

View in Genome Browser
Species Human (GRCh38)
Location 11:61110012-61110034
Sequence GAGGCTAGGAAGGATGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 966
Summary {0: 1, 1: 0, 2: 13, 3: 130, 4: 822}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083199262_1083199269 14 Left 1083199262 11:61109975-61109997 CCACAGTTTTGGCAATAGCAGGA 0: 1
1: 0
2: 1
3: 12
4: 142
Right 1083199269 11:61110012-61110034 GAGGCTAGGAAGGATGGTGCAGG 0: 1
1: 0
2: 13
3: 130
4: 822
1083199266_1083199269 -10 Left 1083199266 11:61109999-61110021 CCTCAGGCTTCATGAGGCTAGGA 0: 1
1: 0
2: 0
3: 16
4: 224
Right 1083199269 11:61110012-61110034 GAGGCTAGGAAGGATGGTGCAGG 0: 1
1: 0
2: 13
3: 130
4: 822

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083199269 Original CRISPR GAGGCTAGGAAGGATGGTGC AGG Intronic
900269769 1:1781091-1781113 GAGGCCATGAGGGATGGAGCAGG + Intergenic
900889863 1:5441909-5441931 GAGGCTAAGAAAGGTGGAGCTGG + Intergenic
901133531 1:6978051-6978073 GAGGCCAGGAAGGGTAGTGGGGG + Intronic
901640031 1:10688473-10688495 GAGTCTAGAAAGCATGGTGGCGG + Intronic
901751370 1:11412176-11412198 GAGGGTGGAAAGGATGGTGGGGG - Intergenic
902547246 1:17197779-17197801 GAGGGCAGGAAGGTTGGTGATGG + Intergenic
903211029 1:21818827-21818849 GAGGCCAGGAAAGAAGGGGCAGG - Intronic
904171812 1:28596696-28596718 GAGGCTGGGAAGGGTAGTGGTGG - Intronic
904230089 1:29062190-29062212 GAGACTAGGAAGAATAGTGAAGG + Intronic
904850110 1:33452803-33452825 GAGGTTAGGAAGGGTAGTGGGGG + Intergenic
905353397 1:37363240-37363262 GAGGCAAAGGAGGATGGGGCGGG - Intergenic
905664929 1:39757651-39757673 GAGGGTTGGAAGGATGATGGTGG - Exonic
905811561 1:40917026-40917048 GAGGCTGGGCAGGAGGGTGGAGG + Intergenic
906208384 1:43998997-43999019 GAGGCTCAGGAGGAGGGTGCTGG - Intronic
906352189 1:45071266-45071288 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
906392177 1:45427754-45427776 GAGGCTGGGAAGGGTAGTGTGGG + Intronic
906816303 1:48883373-48883395 TAGGCAAGGAAGGATGTAGCAGG - Intronic
906972442 1:50530486-50530508 GAGGTTGGGAAGGGTGGTGGGGG + Intronic
907739835 1:57154185-57154207 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
908112707 1:60913047-60913069 GAGGCTGGGAAGAATAGTGGGGG - Intronic
908464338 1:64376718-64376740 GAGGCTGGGAAGGGTAGTGAGGG - Intergenic
909598818 1:77439552-77439574 GAGGCTAGGAAGAGTGATGAGGG - Intronic
910383277 1:86653780-86653802 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
910991198 1:93058359-93058381 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
911012369 1:93294602-93294624 GAGGCTGGGAAGGGTAGTGGTGG + Intergenic
911240871 1:95464538-95464560 GAGGCCGGGAAGGATAGTGGGGG - Intergenic
911283579 1:95961269-95961291 GAGGCTGGGAAGGATACTGGAGG - Intergenic
912202949 1:107479228-107479250 GAGCTTAGGAAAGATGGTGGTGG - Intronic
912233289 1:107820455-107820477 GAGGCTAGGAAGGGGAGTGGGGG + Intronic
912522366 1:110254334-110254356 GAGGCTTGGGAGGATGGTCAGGG + Intronic
912960725 1:114193144-114193166 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
914744127 1:150488803-150488825 GAGGCTGGAAAGGATGGGGGAGG - Intronic
915321152 1:155057156-155057178 GTGGCAAGGAAGGTTGGGGCTGG - Intronic
915337804 1:155157265-155157287 GAGGCTGGGAAGGATAGTAGGGG + Intergenic
915693402 1:157714261-157714283 GAGGCTGGGAAGGATAGTAGAGG - Intergenic
916065641 1:161133272-161133294 GGGGGTGGGGAGGATGGTGCGGG + Intergenic
916368938 1:164067163-164067185 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
916729724 1:167555088-167555110 GAGGCCAGGAAGGGTAGTGGGGG - Intergenic
917258128 1:173138443-173138465 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
918027747 1:180769419-180769441 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
918090250 1:181286311-181286333 GAGGCTGGGAAGGGTAGTGAGGG + Intergenic
918504716 1:185240136-185240158 GAAGCTAAGAAGGAGGGTGAAGG + Intronic
918665702 1:187147942-187147964 GAAGCTGGGAAGGGTGGTGAGGG - Intergenic
918888214 1:190225470-190225492 GAGGCCAGGAAGGGTAGTGGGGG + Intronic
919072139 1:192769305-192769327 GAGGCTGGGAATGATAGTGAGGG + Intergenic
919228920 1:194746797-194746819 GAGGCTGGGAAGGTTTGTGGGGG + Intergenic
919265325 1:195256013-195256035 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
919348406 1:196416921-196416943 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
919761780 1:201102604-201102626 GAAGCTAGGGAGGATGATGATGG - Intronic
919989359 1:202698414-202698436 GAGGCTCTGCAGGATGGTGGAGG - Intronic
920018193 1:202930705-202930727 GAGGCTGGGAAGGACAGTGGGGG - Intergenic
920035115 1:203060515-203060537 GAGGATGGGAAGGAAGGGGCAGG - Intronic
920202705 1:204269545-204269567 GGGGCTGGGAAGGATGGTGAGGG - Intronic
920258676 1:204674207-204674229 GGGACTAGGAAGGGTGGGGCAGG + Intronic
921241607 1:213189797-213189819 GAGGCTGGAAAGGATCGTGTAGG - Intronic
921325413 1:213983099-213983121 GAGGCTAGGAAGGGCGGGCCGGG + Intergenic
921457272 1:215387121-215387143 GAGGCTGGGAAGGGTAGTGAAGG + Intergenic
921557141 1:216612357-216612379 GAGGGAAGGAAGGAAGGGGCGGG + Intronic
922236029 1:223723454-223723476 GAGGCTGGTAAGGGGGGTGCTGG - Intronic
922843778 1:228666579-228666601 GAGGCTAGGAAGGATAGGAAGGG - Intergenic
923036420 1:230287942-230287964 AAGGAAAGGAAGGAAGGTGCGGG + Intergenic
923515951 1:234698251-234698273 GAGGCAAGGCAGGATGGGGGTGG - Intergenic
923691232 1:236195259-236195281 GAGGCTGGGAAGGGTAGTGGCGG - Intronic
923824267 1:237482350-237482372 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
924107697 1:240666006-240666028 GATGCTAAGAACGATGCTGCAGG - Intergenic
924112119 1:240710612-240710634 GAGGCTAGGAAGGGGAGTGGGGG - Intergenic
924488075 1:244506909-244506931 GATGCTGGGAAGGCTGGTGGGGG - Intronic
924751501 1:246896540-246896562 AAGGCTGGGTAGGATGGGGCAGG + Intronic
1063169949 10:3499876-3499898 AAGGGTAGGAAGGAGGGTTCTGG + Intergenic
1063385769 10:5615694-5615716 GAGGCCAGGCTGGATGGGGCTGG - Intergenic
1063409015 10:5822333-5822355 AAGGCTGGTAAGCATGGTGCAGG + Intronic
1063774907 10:9251905-9251927 GAGGCTGGGAATGATAGTGATGG + Intergenic
1064447121 10:15405675-15405697 GAGGCTGGGAAGGGTAATGCAGG + Intergenic
1065708185 10:28490241-28490263 GAGGCTGGGAAGGTTAGTGAGGG - Intergenic
1065916756 10:30359552-30359574 GGGGAAAGGAAGGATGGTGGGGG - Intronic
1066130854 10:32392296-32392318 GAGGCTGGGAAGGATAGTGGAGG - Intergenic
1066148537 10:32589140-32589162 GAGGCTAGTAAGCATAGTGGGGG - Intronic
1066514112 10:36136751-36136773 GAGGCTGGGAAGGGTTGTGGGGG - Intergenic
1066568168 10:36742442-36742464 GTGGCTCGGAAGGCTGGGGCAGG + Intergenic
1067070025 10:43124417-43124439 CAGGCAAGCAAGGACGGTGCAGG + Intronic
1067947116 10:50696598-50696620 GGGGCTAGGAGGTATGGGGCAGG - Intergenic
1068506334 10:57904538-57904560 GAGGCTGGGAAGGGTAGTGGAGG - Intergenic
1068709764 10:60121314-60121336 GAGGCTGGGAAGGGTAGTGAGGG + Intronic
1068840136 10:61603492-61603514 GAGGCTGGGAAGGGTAGTGCAGG - Intergenic
1069052085 10:63805929-63805951 GAGGCTGGGAAGGGTAGTGAGGG - Intergenic
1069872266 10:71540417-71540439 GAGTCTGGGAAGGCTGGGGCGGG - Intronic
1070080429 10:73180906-73180928 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
1070328042 10:75400598-75400620 GAGGGCAGGAAAGATGCTGCTGG - Intronic
1070882427 10:79861588-79861610 GGGGCTAGGAGGTATGGGGCAGG - Intergenic
1070939669 10:80333287-80333309 GAGGCTGGGAGGGATAGTGGGGG + Intergenic
1071108799 10:82129997-82130019 GAGGCTTGGAAGGGTAGTGATGG - Intronic
1071406293 10:85336224-85336246 GAGGCTGGGAAGGATACTGGGGG + Intergenic
1071648997 10:87377899-87377921 GGGGCTAGGAGGTATGGGGCAGG - Intergenic
1071691329 10:87822626-87822648 GAGGCTGGGAAGAATAGTGGTGG + Intronic
1071829859 10:89360910-89360932 GAGGCAAGGAAGGATGCTGCGGG - Intronic
1071885756 10:89949016-89949038 GAGGCTAGGAAGGGTAGTAGGGG + Intergenic
1071970221 10:90898076-90898098 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
1072477916 10:95781245-95781267 GAGGCTGGGAAGGGTAGTGGGGG + Intronic
1072520908 10:96229238-96229260 GAGGCTGGGAAGGGTGGTCGAGG - Intronic
1072864218 10:99041583-99041605 GAGGCTAGGGAAGCTGGTGCTGG - Intronic
1072976214 10:100061077-100061099 GAGGCTGGGAAGGATGGTGGGGG + Intronic
1073061125 10:100734528-100734550 GAGGCTATCAAGGAAAGTGCTGG - Intergenic
1073137220 10:101226764-101226786 GAGGCGAGGAAGGAGCGGGCCGG + Exonic
1073264160 10:102214556-102214578 GAGGCTGGGAAGGGTAGTGAGGG + Intergenic
1073452805 10:103619612-103619634 GAGGCTGCGAAGGCTGGGGCTGG - Intronic
1074115300 10:110453393-110453415 GAGGTTGGGAAGGATAGTGGGGG + Intergenic
1074395630 10:113095804-113095826 GAGGCTAGGATGCAGGGTGCAGG - Intronic
1074872336 10:117587131-117587153 GAGCCAAGGAAAGATGGTGGAGG - Intergenic
1075600392 10:123763398-123763420 GTGGATAGGTAGGATGGTGTAGG - Intronic
1075684732 10:124355642-124355664 GAGGCTGGGAAGGATAGTTAGGG + Intergenic
1075934632 10:126328951-126328973 GAGGGTAGGAAGGAGGAAGCTGG + Intronic
1075975666 10:126691859-126691881 GGGGCTGGGAAGGGTGGGGCAGG + Intergenic
1076999198 11:314214-314236 GGACCTTGGAAGGATGGTGCTGG - Exonic
1077395698 11:2320055-2320077 TAGGCTGGGAAGGAAAGTGCCGG + Intergenic
1077428845 11:2504319-2504341 GAGGCTGGGAAGGGTAGTGGGGG + Intronic
1077850629 11:6072273-6072295 GAGGCTGGGAAGAGGGGTGCAGG + Intergenic
1077959083 11:7053948-7053970 GAGGCTAGGAAGCACAGTGGGGG - Intronic
1078454044 11:11461252-11461274 GCGGCTAGGATGGCTGGTGCAGG + Intronic
1078750711 11:14159879-14159901 GAGGCTGGGAAGGGTAGTGGGGG + Intronic
1079260275 11:18871925-18871947 ATGGCTGGGAAGGATGGTGGTGG - Intergenic
1079517187 11:21283017-21283039 GAAGCTGGGAAGGATAGTGGGGG + Intronic
1080387858 11:31820124-31820146 GAGGCTGGGAGGGAGGGAGCCGG + Intronic
1080601320 11:33822743-33822765 GAGGCTAGGAAGGATACTGAGGG - Intergenic
1080836911 11:35947799-35947821 AAGGCATGGAAGCATGGTGCAGG - Intronic
1080883543 11:36345071-36345093 GAGGCTAGGAAGGGAGGTCAGGG + Intronic
1081356984 11:42123851-42123873 GAGGCTGGGACGAGTGGTGCAGG - Intergenic
1081501324 11:43669601-43669623 GAGGCAAGGAAGGATGCTTCTGG - Intronic
1081504423 11:43700485-43700507 GAAGCTAGGAAGGGTAGTGGGGG - Intronic
1081722015 11:45296725-45296747 GAGGCTTGGAAGGGTAGTGGGGG - Intergenic
1083077236 11:60053699-60053721 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1083168246 11:60905286-60905308 CATGCCAGGAAGGATGGTGCTGG + Intronic
1083171593 11:60926700-60926722 CAAGCTTGGAAAGATGGTGCAGG + Intronic
1083199269 11:61110012-61110034 GAGGCTAGGAAGGATGGTGCAGG + Intronic
1085007579 11:73107593-73107615 GAGGCTGGGAAGGGTAGTGAGGG - Intronic
1085021768 11:73214505-73214527 AAGGGAAGGGAGGATGGTGCAGG + Intergenic
1085179049 11:74517969-74517991 GAGGCTAGGAAGGGTAGTTGGGG + Intronic
1085224051 11:74902762-74902784 GAGGCTGGGAAGGATAGTGGGGG + Intronic
1085424790 11:76394336-76394358 GAGGCTGGGAAGGATAGTGGAGG - Intronic
1086066278 11:82748699-82748721 GAGGCTGGGAAGGGTAGTGGTGG + Intergenic
1086260926 11:84939572-84939594 GTGGCTAGGAAGGATAGTGGTGG - Intronic
1086728906 11:90223375-90223397 AAGGCAAGGAAGAAGGGTGCTGG - Intergenic
1086855693 11:91862466-91862488 GAGGCTGGGAGGGGTAGTGCAGG + Intergenic
1086962609 11:92994765-92994787 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1087888567 11:103509417-103509439 GAAGCTGGGAAGGATAGTGGAGG + Intergenic
1088005703 11:104937246-104937268 GAGGCTAGGAAGCATACTGTGGG + Intergenic
1088076732 11:105858657-105858679 GAGGCTGGGAAGGATAGTGAGGG - Intronic
1088577686 11:111287538-111287560 GAAGCTAAGAAGAAGGGTGCAGG - Intergenic
1088953466 11:114594017-114594039 GAGGCTGGGAAGGGTGGTGGGGG + Intronic
1089078566 11:115758699-115758721 GAGGCAAGGAGGGATGGTGGGGG + Intergenic
1089575871 11:119442686-119442708 GAGGCTGAGAAGGATAGTGTGGG - Intergenic
1089690289 11:120182889-120182911 GAGGCTGGGGAGGATGTGGCAGG + Intronic
1089717538 11:120376793-120376815 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
1089718595 11:120389672-120389694 GAGGCTGGGAAGGGTAGTGGAGG - Intronic
1089926851 11:122267800-122267822 GAGGCTAGACTGGATGGAGCTGG - Intergenic
1089937855 11:122384267-122384289 GAGGCTGGGAAGGATAGTAGGGG + Intergenic
1089953478 11:122550221-122550243 GAGGCTGGGACGGGGGGTGCAGG - Intergenic
1090653474 11:128825423-128825445 GAGGCTGAGAAGGAGGGAGCAGG + Intergenic
1090691459 11:129187360-129187382 GAGGCTGGGAAGGGTGGTGGGGG + Intronic
1090715473 11:129426726-129426748 CAGGCAAGGAAGGATGGAGTTGG - Intronic
1091783770 12:3230206-3230228 GATGCTTGGAAGGCCGGTGCCGG + Intronic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1092108837 12:5945064-5945086 GAGCCTGGGCAGGGTGGTGCGGG - Intronic
1093419445 12:18957973-18957995 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
1093476000 12:19555042-19555064 GAGGCTAGGAAGGGTAGTGGGGG - Intronic
1093532102 12:20177840-20177862 GAGGCTGGGGAGGGTGTTGCAGG + Intergenic
1093925222 12:24902832-24902854 AAGGCGAAGGAGGATGGTGCAGG + Intronic
1093984516 12:25514499-25514521 GAGGCTGGGAAGGGTAGTGGGGG + Intronic
1094380031 12:29832520-29832542 GAGGCTGGGAAGGGTGGTGGGGG - Intergenic
1094410500 12:30163472-30163494 AAGGCTAGGAAGGATAGTGGAGG - Intergenic
1094441030 12:30477281-30477303 GAGGCTGGGAAGGGTAGTGGAGG + Intergenic
1094773597 12:33695220-33695242 GAGGCTGGGAAGGATAGTGGGGG - Intergenic
1096014310 12:48254404-48254426 GAGGCTAGGAAGGGTAGTTGGGG + Intergenic
1096098983 12:48957425-48957447 GAGGGAAGGAAGGAGGGAGCCGG - Exonic
1096889479 12:54753668-54753690 GAGGCTAGGAAGGAAGGATGAGG - Intergenic
1096949468 12:55451308-55451330 GAGGCTGGGAAGTATAGTGGGGG - Intergenic
1097183298 12:57183253-57183275 GAGGATAGGGATGATGGTGGGGG + Intronic
1097563901 12:61242899-61242921 GAGGCTAGGAAGGGTAGTTGAGG + Intergenic
1097770443 12:63578303-63578325 GAGGCTGGGAAGGATAGTGAGGG + Intronic
1098047723 12:66419291-66419313 GAGGCTAGGAAGGGTAGTGGGGG + Intronic
1098108188 12:67093318-67093340 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1098165072 12:67687836-67687858 GAGGCTAGGAAGGGTAGTGGGGG + Intergenic
1098427989 12:70387973-70387995 GAAGCTAGGAAGGGTAGTGGAGG - Intronic
1099100354 12:78432266-78432288 GAGGCTGGGAAGGGTAGTACAGG - Intergenic
1099125346 12:78748641-78748663 GAGGCTAGGAAGGGCAGTGAGGG + Intergenic
1099293733 12:80804367-80804389 GAGGCTGGGAAGGATAGTGGAGG - Intronic
1099657984 12:85520098-85520120 GAGGGTGGGAAGGATAGTGAGGG + Intergenic
1099745349 12:86695766-86695788 GAGGCTAGGAAGGGTAGTTAGGG + Intronic
1100449466 12:94691544-94691566 GAGGCTGGGAAGGGTAGTGAGGG - Intergenic
1100762273 12:97821871-97821893 GAGTCTAGGATGAATGGTGAAGG - Intergenic
1100923339 12:99515322-99515344 GAGGCTGGGAAGAATAGTGGGGG - Intronic
1100946873 12:99794687-99794709 GAGGCTGGGAAGGGTAGTGGGGG + Intronic
1101668977 12:106848957-106848979 GAGGCTGGGAAGGATAATGGGGG + Intronic
1102405881 12:112673834-112673856 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
1102639498 12:114354544-114354566 GAGGTTTGGAAGGTTGGGGCTGG + Exonic
1102648846 12:114422209-114422231 GAGGCTGGGAAGGGTAGTGGTGG + Intergenic
1103241914 12:119420558-119420580 GAGGCTGGGAAGGATAGTGGGGG + Intronic
1104381677 12:128312990-128313012 GAGGAGAGGGAGGATGGAGCAGG - Intronic
1104983067 12:132582563-132582585 GGGGCTAGGAAGGATGAGGAGGG + Intronic
1105682291 13:22741408-22741430 GAGGCTGGGAAGGATGGGAGTGG + Intergenic
1105806611 13:23955183-23955205 GAGGAAAGGGAGGATGGTGAGGG + Intergenic
1105844452 13:24282148-24282170 GAGGCTAAGCATGATGGTGGGGG + Intronic
1105936881 13:25108706-25108728 GAGGCTGGGAAGGGTAGTGGAGG - Intergenic
1106287386 13:28329511-28329533 GAGGCGAGGAAGCACAGTGCGGG + Intronic
1106689066 13:32094510-32094532 GAGGCTGGGAAGGATAGTGGGGG - Intronic
1106716318 13:32392306-32392328 GAGGCTAGGAAAGCTGGAGTTGG - Intronic
1106784736 13:33095383-33095405 GAGGCTAGGAAGGGTGTGGAGGG - Intergenic
1106921567 13:34569816-34569838 GAGGCTGGGAAGGGTAGTGAGGG + Intergenic
1107898651 13:44990214-44990236 GAGGCTAGGAAGGCAGGTCGGGG - Intronic
1108001520 13:45909523-45909545 GAGCCTAGAAAGTATGGTGAGGG + Intergenic
1108007220 13:45961526-45961548 GAGGCTGGGAAGGGTAGTGGGGG + Intronic
1108171094 13:47742862-47742884 GAGGCTGGGAAGGATAGTGCAGG + Intergenic
1108232076 13:48355912-48355934 GAGGCTGGGAAGGGTGGTGGAGG + Intronic
1108461931 13:50675605-50675627 GAGGCTTGGAAGGATGGAGTAGG - Intronic
1109804950 13:67427285-67427307 GATGCTGGGAAGGGTGGTGGGGG - Intergenic
1109824869 13:67705518-67705540 GAGGCTGGGAAGCGTGGTGGAGG + Intergenic
1110519134 13:76454560-76454582 GAGGCTGGGAAGGTTTGTGGCGG + Intergenic
1110888672 13:80671079-80671101 GAGGCTAGGAAGGTTAGTGGAGG - Intergenic
1111484718 13:88881298-88881320 GAGGCTGGGAATGATAGTGGGGG - Intergenic
1111671897 13:91341963-91341985 TAGCCTAGGAAGGTGGGTGCTGG - Intergenic
1111838289 13:93416697-93416719 GAGGCTGGGAAGGGTAGTGGAGG - Intronic
1112015685 13:95329551-95329573 AATGCTAGGAGGTATGGTGCAGG + Intergenic
1112569890 13:100584470-100584492 GAGGCTAGGAAGGGTAGTAGGGG + Intronic
1112573168 13:100612081-100612103 GAGGCCGGGCAGGCTGGTGCAGG - Intronic
1112853281 13:103733523-103733545 GAGGCTGGGAAGGGTAATGCAGG + Intergenic
1113259366 13:108544743-108544765 GAGTCTAGGAAGAATGCTGGTGG - Intergenic
1113632268 13:111896459-111896481 GAGGCTGGGAAGGCTTGTGCTGG + Intergenic
1115051544 14:29069496-29069518 GACGCTGGGAAGGGTGGTGGGGG - Intergenic
1115114384 14:29862025-29862047 GAGGCTGGGAAGGGTAGTGAGGG - Intronic
1115135039 14:30097718-30097740 GAGTCTGGGAAGGGTAGTGCTGG + Intronic
1115171306 14:30510634-30510656 GAGGCTGGGAAGGGTAGTGGAGG + Intergenic
1116034186 14:39608269-39608291 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
1116116464 14:40658022-40658044 GAAGCTGGGAAGGATGCTGGAGG - Intergenic
1116220638 14:42082807-42082829 GAGTCTAGGAAGGGTAGTGAGGG - Intergenic
1116265005 14:42676701-42676723 GAGGCTAGGAAGGGTAATGAGGG + Intergenic
1116269688 14:42745586-42745608 GAGGCTGGGAAGGCTAGTGAGGG + Intergenic
1116413476 14:44652192-44652214 GAGACTGGGAAGGATGGGGTCGG + Intergenic
1116491981 14:45515446-45515468 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1116810224 14:49532812-49532834 GAGGCTGGGAAGGGTAGTGGAGG + Intergenic
1117667398 14:58070860-58070882 GAGGCTGGGAAGGGTAGTGGAGG - Intronic
1117682046 14:58214161-58214183 GAGGCCAGGGAGGATAGTGGAGG - Intronic
1117780887 14:59230586-59230608 GAGGCTGGGAAGGGTAGTGGGGG + Intronic
1117804108 14:59472471-59472493 CAGCCTGGGAAGGATGGGGCTGG - Intronic
1118097380 14:62552619-62552641 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1118383056 14:65233411-65233433 GAGGCTGGGAAGGCTTGTGGCGG - Intergenic
1118538507 14:66795982-66796004 GAGGCTAGGAAGGGTAGAGGGGG - Intronic
1118556425 14:67028029-67028051 GAGGCTGGGAAGGATGGTGTGGG - Intronic
1118916339 14:70110336-70110358 GAGGCTGGGAAGGGTGGTGGGGG - Intronic
1119038537 14:71251417-71251439 GAGGCTGGGAAGGGTGGTGGGGG + Intergenic
1119668220 14:76499517-76499539 GAAGCCAGGAAGGATGAGGCAGG - Intronic
1119680050 14:76585372-76585394 CAGGCTAGGAATGATGGGGCTGG - Intergenic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1120426752 14:84358137-84358159 GAGGCTGGGAAGGGTAGTGGTGG + Intergenic
1120668971 14:87342087-87342109 GAGGCTAGGAAGGATAGTTGGGG + Intergenic
1120736622 14:88060189-88060211 GAGGCTGGGAAGGGTAGTGAGGG + Intergenic
1120974421 14:90236134-90236156 GGGGGTAGGAAGGAGGGGGCGGG - Intergenic
1121138116 14:91516776-91516798 GAGTCTGGGAAGGATGTTGAGGG - Intergenic
1121574219 14:94970045-94970067 GAGGCTAGAAAGGAAGGTTAAGG + Intergenic
1121727544 14:96164062-96164084 GAGGCTGGGAAGGATATTGCAGG + Intergenic
1122031935 14:98918745-98918767 GAGGATAGGAAGGGAGGTGAAGG + Intergenic
1122150634 14:99724352-99724374 GAGGCTTGGATGGATGCTGGAGG - Intronic
1122793715 14:104195267-104195289 GAGGCAGGGAAGGGTGGTGCGGG + Intergenic
1122857552 14:104567182-104567204 GAGGCAAGGAAGCCGGGTGCGGG - Intronic
1124843534 15:33267397-33267419 GAGGCTAAGAATGGTAGTGCGGG - Intergenic
1125134072 15:36321155-36321177 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
1125510848 15:40291605-40291627 GAGGCTATGAAAGAAGCTGCGGG - Exonic
1126464712 15:48951234-48951256 GGGGGTAGGAAGGATGTGGCTGG - Intronic
1126497651 15:49310036-49310058 GAGGCCAGGAAGGGTAGTGGGGG - Intronic
1126566642 15:50108177-50108199 GGGGCTAGGAGGGATGGTCTTGG - Intronic
1126862343 15:52897917-52897939 GAGACTGGGAAGGCTAGTGCTGG - Intergenic
1126927687 15:53608841-53608863 GAGGCTGGGAAGGGTAGTGTGGG + Intronic
1126975357 15:54172101-54172123 GAGGCTGGGAAGGGTAGTGGTGG + Intronic
1127155315 15:56118340-56118362 GAGGCTTGGAAGGGTAGTGGGGG - Intronic
1127459358 15:59183829-59183851 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
1127493870 15:59491412-59491434 GAGGCTGAGAAGGATAGTGGGGG + Intronic
1127840787 15:62829785-62829807 GAGGCTGGGAAGGGTAGTGAGGG - Intronic
1128402629 15:67299263-67299285 GAGGCTGGGAAGGGTAGTGCGGG + Intronic
1128705717 15:69836345-69836367 GAGTGTTGGAAGGATGCTGCTGG - Intergenic
1128748992 15:70135065-70135087 GGGGATAGGCAGGATGGTGCCGG - Intergenic
1128800530 15:70494080-70494102 GAGGCTAGGCTGGCTGGTGGAGG - Intergenic
1128859929 15:71060495-71060517 GAGGCTAGGAAGGGTAGTAGTGG - Intergenic
1128866207 15:71116501-71116523 GAGGCTGGGAGGTACGGTGCTGG - Intronic
1128886116 15:71289717-71289739 GAGGCTAGGAAGGCAGGTTAGGG - Intronic
1129122146 15:73405507-73405529 GAGGCTGGGAAGGATAGGGAAGG - Intergenic
1129501773 15:76045771-76045793 GAGGCTGGGAAGGGTGGAGCAGG + Intronic
1129907530 15:79199212-79199234 GAGGCTGGGAAGGGTAGTGAAGG - Intergenic
1129933072 15:79428335-79428357 GAGGCAAGGAGGGATGGGGGAGG - Intergenic
1130038469 15:80383001-80383023 GAGGCTAGGAAGGGTGGAGCAGG + Intronic
1130347659 15:83063704-83063726 TAGGCCAGACAGGATGGTGCAGG - Intronic
1130419117 15:83724694-83724716 GTGGCTAGGAAGGATAGTGGCGG - Intronic
1130578580 15:85115220-85115242 AATGCTGGGAAGGATGGTCCTGG - Intronic
1130896529 15:88174432-88174454 GAGGCCAGGAGGGAAGATGCTGG - Intronic
1131352819 15:91717282-91717304 GAGGGAAGGAAGGATTGTGTGGG - Intergenic
1131511424 15:93051411-93051433 GAGGCCAGGAAGGAAGCTGGTGG - Intronic
1131829365 15:96344384-96344406 GAGGCAAGGAGAGATGGGGCGGG - Intergenic
1131836025 15:96392084-96392106 CAGGCAATGAAGGATGGTGATGG + Intergenic
1131887819 15:96937460-96937482 GAGGCTGAGAAGGATAGTGGTGG - Intergenic
1132708707 16:1257174-1257196 GAGGCCAGGATGGATGGAGCAGG + Intronic
1133207590 16:4242593-4242615 GAGGCTGGGAAGGTTGTTCCAGG - Intergenic
1133384608 16:5358958-5358980 GAGGCTAGGAAGGGTAATGGAGG - Intergenic
1133751101 16:8726077-8726099 GAGGCTGGGAAGGGTAGTGGCGG - Intronic
1133827428 16:9290843-9290865 GAGGCTAGGATAGATAGTGGTGG - Intergenic
1133902058 16:9985691-9985713 GAGGCTAGGAAGGGTAGTTGGGG + Intronic
1134637996 16:15807612-15807634 GAGTCTGGGAAGGCTGGAGCTGG + Intronic
1135196988 16:20402907-20402929 CAGGCTAGAAAGGCAGGTGCCGG - Intronic
1135260894 16:20979699-20979721 GAGGCAGAGAAGGATGGGGCAGG + Intronic
1135323520 16:21512156-21512178 GAGTCTGGGAAGGATGGAGAAGG + Intergenic
1135604768 16:23813914-23813936 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1135604785 16:23813954-23813976 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1135842933 16:25893239-25893261 AAGCCGATGAAGGATGGTGCTGG + Intronic
1136248592 16:28989340-28989362 CAGGCTGGCAAGGATGGTGTTGG - Intronic
1136335008 16:29605421-29605443 GAGTCTGGGAAGGATGGAGAAGG + Intergenic
1136547655 16:30964870-30964892 GTGGGTAGGAAGTATGGCGCTGG - Exonic
1136559564 16:31031126-31031148 GAGGTTAGGAAGGATGTGGAAGG - Intergenic
1136584306 16:31174081-31174103 GAGGCTGGGCATGGTGGTGCAGG + Intergenic
1137678275 16:50315372-50315394 GAGGCCCTGGAGGATGGTGCAGG - Exonic
1138331900 16:56221982-56222004 GAGGCTAGGTGGGATGTTGAGGG + Intronic
1138469154 16:57218485-57218507 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
1138486723 16:57349915-57349937 GATGGAAGGAAGGAAGGTGCAGG - Intergenic
1138548068 16:57731131-57731153 GAGGCAAGGAAAGAGGGTGAGGG - Intronic
1138856090 16:60694655-60694677 GAAGCTAAGAAGGGTAGTGCAGG + Intergenic
1139085738 16:63583491-63583513 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1139583799 16:67888312-67888334 ACTGCTGGGAAGGATGGTGCTGG + Intronic
1139967803 16:70755278-70755300 GGGCCTGGGAAGGAAGGTGCAGG + Intronic
1140300198 16:73749938-73749960 GAGGCTAGTAAGTATGGTTTGGG - Intergenic
1140544669 16:75795631-75795653 GAGGCTAGGAAAGGTAGTGGGGG - Intergenic
1140771228 16:78205810-78205832 GAAGGTAGGAAGGAAGGTGTGGG - Intronic
1141477750 16:84284950-84284972 GAGGATAGGAAGGATGAGGCAGG - Intergenic
1142035723 16:87861240-87861262 GAGTCTGGGAAGGATGGAGAAGG + Intronic
1142290915 16:89193260-89193282 GAGGTTAGGGAGGAGGGGGCCGG - Intronic
1142303528 16:89272988-89273010 GAGGCTGGGAAGGGTTGTGGGGG + Intronic
1142338858 16:89508036-89508058 CAGGCGAGGGCGGATGGTGCGGG - Intronic
1142909561 17:3076457-3076479 GAGGCTGGGAAGGATAGTGGTGG - Intergenic
1142924937 17:3227357-3227379 GAGGCTGGGAAGGATAGTGGTGG + Intergenic
1143869114 17:9945237-9945259 GAGACCAGGAAAGATGGTGGTGG - Intronic
1143940458 17:10535616-10535638 CAGGGTAGAAAGGATGGTGTTGG - Intronic
1144374802 17:14628287-14628309 AAGGGAAGGAAGGATGGTGGCGG + Intergenic
1144831048 17:18131415-18131437 GAGGGTAGGAGGGCTGGTGTTGG - Intronic
1145031272 17:19507113-19507135 GAGGCTAGGGAGGCTGAGGCAGG + Intronic
1145037958 17:19554292-19554314 AAGGCTAAGAAGGATGTTGAGGG + Intronic
1147341761 17:39756530-39756552 GAGGGGAAGAAGGAGGGTGCAGG + Intergenic
1147487422 17:40830466-40830488 GAGGCTGGGAAGGGTAGTGTGGG + Intronic
1148243478 17:46014953-46014975 GAGGCTGGGAAGGGTAGTGAGGG + Intronic
1148445976 17:47737469-47737491 GAGGATAGCAAGGATAGTGTGGG - Intronic
1148801833 17:50232430-50232452 CAGTCTTGGAAGGATGGTTCAGG - Intergenic
1149948788 17:60961711-60961733 GAGGCCAGGAAGTGTGGGGCAGG - Intronic
1150169526 17:62978572-62978594 GAGACTGGGATGGATGGTGTGGG + Intergenic
1150859682 17:68788447-68788469 GAGGCTAGCAAGGGTAGTGGGGG - Intergenic
1150945799 17:69744152-69744174 GAGGCTGGGAAGGGTAGTGTGGG + Intergenic
1151128875 17:71875219-71875241 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1151403922 17:73874612-73874634 GAGGCTGGGGAGGCTGGGGCCGG - Intergenic
1151552944 17:74832349-74832371 GAGGATATGAAGGCGGGTGCTGG - Intronic
1151791195 17:76307148-76307170 GGGGCTAGGAAGGAGGGGGTGGG + Intronic
1152367456 17:79864837-79864859 CAGGCTAGCAGGGAAGGTGCAGG - Intergenic
1152681036 17:81668044-81668066 GAGGCTTGGAAGGAGGCTGTGGG + Intronic
1153120958 18:1726291-1726313 GAGGCTGGGAAGGATAGTAGGGG - Intergenic
1153285208 18:3450145-3450167 GAGGCGAGGAGGGAAGGTACAGG - Intronic
1153430591 18:5012181-5012203 GAGGCTAGGAAGGGTAGTTGGGG + Intergenic
1153714388 18:7831772-7831794 GAGGCTGGGAAGGGTAATGCGGG - Intronic
1154028073 18:10725893-10725915 CAGGCTGGGCAGGAGGGTGCAGG + Intronic
1154031152 18:10755668-10755690 GAGGCTGGGCAGAATGGTGGAGG + Intronic
1155309217 18:24507920-24507942 GAGGCTGGGAAGGGTAGTGAGGG + Intergenic
1155470784 18:26190137-26190159 GAGGCTGGGAAGGGTAGTGGGGG + Intronic
1155503117 18:26506385-26506407 GGGGCTGGGAAGGATGGGGAAGG + Intronic
1155534398 18:26802006-26802028 GAGGCTAGGAAGGATAGCAGGGG + Intergenic
1155591512 18:27433054-27433076 GAGGCTGGGAAGCATGGCACTGG - Intergenic
1156124412 18:33886163-33886185 GAGGCTAGGAAGGGGAGTGAGGG + Intronic
1156325159 18:36067911-36067933 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1157505324 18:48222181-48222203 GAGGCTAGGGAGGGTGCAGCAGG - Intronic
1157614348 18:48977841-48977863 GAGGCTAGGAGGCTTGGTGAGGG + Intergenic
1157760386 18:50259442-50259464 GAGGCTGGGAAGGATAGTGGGGG + Intronic
1157875789 18:51272352-51272374 GAGGCTGGGAAGGGTTGTGGGGG + Intergenic
1158015913 18:52784081-52784103 GAGTCTAGGAAGGGTGGAGGAGG - Intronic
1158114788 18:53983222-53983244 GGGGCTGGGAAGGCTGGTGGGGG + Intergenic
1158145032 18:54302768-54302790 GAGGCTGGGAAGGGTAGTGGAGG - Intronic
1158285116 18:55872037-55872059 GAGGCTGCGAAGGATAGTGGGGG + Intergenic
1159423790 18:68257790-68257812 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
1159553098 18:69917388-69917410 GAGGGAAGGAAAGATGGTGCTGG - Intronic
1160065322 18:75568531-75568553 GTGGCAGGGAAGCATGGTGCTGG + Intergenic
1160275310 18:77427524-77427546 GAGGCCAGGAAGGGTGGTGGAGG - Intergenic
1160963433 19:1734935-1734957 GGGGCTGGGCAGGATGGGGCAGG + Intergenic
1161356127 19:3820457-3820479 GAGGCTGGGAAGGCTGGTGTGGG + Intronic
1161725673 19:5927171-5927193 GTGGCTGGGAAAGGTGGTGCTGG + Intronic
1161878577 19:6931080-6931102 GAAGCTGGGAAGGATAGTGAAGG - Intronic
1162596308 19:11632192-11632214 GAGGCTAGGAAGGGTAGTGGAGG + Intergenic
1162698292 19:12494612-12494634 GAGGCTGGAAAGGGTAGTGCGGG + Intronic
1162945007 19:14037743-14037765 GAGGCCAAGGGGGATGGTGCGGG + Intronic
1163107302 19:15132362-15132384 GAGGCTGGGAAGGGTGGTGGGGG - Intergenic
1163224920 19:15952852-15952874 GAGGCTGGGAAGGGTAGTGATGG - Intergenic
1165166851 19:33863177-33863199 GAGGCCAGGCAGGCTGGAGCAGG + Intergenic
1165309271 19:35020852-35020874 GAGGCCAGGGAGGAGGCTGCTGG + Intronic
1165425374 19:35742616-35742638 GAGCCTGGGAAGGATGGGGCAGG + Exonic
1165490288 19:36119469-36119491 GAGGCCAGGGAGGAAGCTGCCGG - Intronic
1165883384 19:39059340-39059362 GAGGCTGGGAAGGATAGTGGAGG - Intergenic
1165985051 19:39761169-39761191 GAGGCTGGGAAGGATAGTAGAGG + Intergenic
1166102192 19:40577310-40577332 GAGGGTAGGAGGGATGGAGAGGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166827874 19:45620798-45620820 GAGGCCAGGAAGGGAGGAGCAGG + Intronic
1167059556 19:47135325-47135347 GAGGCTAGGAAGGGTAGTGGGGG - Intronic
1167229231 19:48271366-48271388 GAGCCTAGGAACGGTGGCGCGGG + Exonic
1167882306 19:52470256-52470278 GAGGCAAAGAAGGGTGGTGGGGG - Intronic
925641575 2:5990395-5990417 GAGCCAAGAAAGGATGGTGGGGG - Intergenic
925750661 2:7088520-7088542 GAGCCTAGCAAGGATGCTACGGG + Intergenic
925983101 2:9192852-9192874 GAGCCTAGGAATGATGGTAGAGG + Intergenic
926206074 2:10835195-10835217 GAGGCCTGGAAGGACGGTTCAGG - Intronic
926214813 2:10898461-10898483 GAGATTAGGAAGGGAGGTGCTGG - Intergenic
926317555 2:11722238-11722260 AAGGCTAGGAAGGATGGAGCTGG - Intronic
926385505 2:12332082-12332104 GAGGCTGGGAAGGGTGGTGGGGG + Intergenic
926867770 2:17378394-17378416 GAGGCTGGGAAGGGTAGTGGTGG - Intergenic
927328541 2:21834973-21834995 GAGGCTAGGAAGCATAGTTAGGG + Intergenic
928502748 2:31914342-31914364 GAGGCTGGGAAGAATAGTGGAGG + Intronic
928707349 2:33964588-33964610 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
930226446 2:48799141-48799163 GAGGCTATGATGGATGGTCCGGG + Intergenic
930527877 2:52553486-52553508 GAGGCTAGGAAGGGTAGTGAGGG + Intergenic
930953847 2:57179116-57179138 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
931854625 2:66288981-66289003 GAGGCTGGGAAGGATATTGGGGG - Intergenic
931926654 2:67080621-67080643 GAGGCTGGGAAGCATGGTTGTGG + Intergenic
932187141 2:69707875-69707897 GAGGCTGGGAAGGGTAGTGGAGG - Intronic
932417826 2:71584363-71584385 GAGGAGGGGAAGGAGGGTGCTGG - Intronic
933338559 2:80992248-80992270 GAGGCTGAGAAGGATAGTGGTGG + Intergenic
933348630 2:81124427-81124449 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
933594967 2:84274176-84274198 GAGGCTGGGATGGATGGTTAGGG - Intergenic
933748611 2:85588754-85588776 GAGGATGGGAGGGATGGGGCAGG - Intronic
934612230 2:95749009-95749031 GAGGCTGGGAAGGATAGTGGGGG + Intergenic
934771026 2:96907703-96907725 GAGGCTAGGAAGCAGAGCGCTGG - Intronic
934841922 2:97630447-97630469 GAGGCTGGGAAGGATAGTGGGGG - Intergenic
935288132 2:101583959-101583981 GAGGCTAGGAAGGGTGATTGGGG - Intergenic
935394114 2:102587473-102587495 GAGTCTGGGAAGGATAGTGAGGG + Intergenic
935749481 2:106218435-106218457 GAGGCTGGGAAGGGTAGTGGAGG + Intergenic
936793614 2:116181782-116181804 GAGGCTAGGAAGGGTAGTGAGGG - Intergenic
936925590 2:117733401-117733423 GAGGTTAGGAAGGGTAGTGGGGG + Intergenic
938077773 2:128349375-128349397 GAGGCTGGGAAGGGTCGTGGAGG - Intergenic
938177404 2:129146663-129146685 GAGGCTGGGAAGGCTTGTGGGGG - Intergenic
938374834 2:130798362-130798384 GAGACTTGGAACGATGGTGCAGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938730543 2:134143625-134143647 GAGGGGTGGAAGGGTGGTGCTGG + Intronic
938934785 2:136118252-136118274 GACGCGAGGAAGGAGGGCGCAGG + Intergenic
939649554 2:144744384-144744406 GAGGCTGGGAAGGGTAGTGAGGG - Intergenic
939948806 2:148443738-148443760 GAGGCTGGGAAGGGTAGTGGGGG + Intronic
939963386 2:148586116-148586138 GAGGCTTGGAAGGGTAGTGGGGG + Intergenic
940443433 2:153747356-153747378 GAGGCTGGGAAGGGTAGTGAGGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941985785 2:171510434-171510456 TAGGCTTGGAAGACTGGTGCAGG - Intergenic
942492714 2:176506053-176506075 GAGGCAAGGAAGCATGTTGGGGG + Intergenic
942663744 2:178293783-178293805 GAGGCTGGGAAGGGTAGTGGAGG - Intronic
943138287 2:183943893-183943915 GAGGCTAGGAAGGGTTGAGGAGG + Intergenic
943164507 2:184302695-184302717 CAGCCTGGGAAGGATGGAGCAGG + Intergenic
943170475 2:184391293-184391315 GAGGCTGGGAAGTGTAGTGCAGG + Intergenic
943304116 2:186238570-186238592 GAGTCTAGGAAAGGTGGAGCAGG + Intergenic
943347660 2:186758950-186758972 GAGGCTGGGAAGGGTAGTGTGGG - Intronic
943361946 2:186930348-186930370 GATGCTGGGAAGGGTGGTGAGGG - Intergenic
943582425 2:189700678-189700700 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
943803264 2:192089185-192089207 GAGGTTAGGAAAGACTGTGCTGG - Intronic
943873346 2:193030537-193030559 GAGACTAGGAAGGATAGTGGAGG + Intergenic
943878258 2:193102240-193102262 GAGGCTGGGCAGGCAGGTGCTGG + Intergenic
944500696 2:200356789-200356811 GAGGCTAGGAAGTATGGCATTGG + Intronic
944534597 2:200696609-200696631 GAGGCTGGAAAGGAAGGTGGAGG + Intergenic
944719341 2:202407318-202407340 GAGGCCAAGAAGGATGGATCAGG - Intronic
945287802 2:208099615-208099637 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
946093639 2:217252786-217252808 AAGACTAGGAAGGAAGCTGCTGG - Intergenic
946415185 2:219536664-219536686 GCGGCTGGGGAGGAAGGTGCCGG + Intronic
946416111 2:219540551-219540573 GAGGCCGGGCGGGATGGTGCTGG + Exonic
947311705 2:228809913-228809935 GAGGCTGGTAAGGATAGTGAAGG - Intergenic
948323511 2:237091874-237091896 GAGGCTGGGAAGGAAGGTCAGGG - Intronic
948539150 2:238674371-238674393 GAGGCTGGGAAGGGTGAGGCAGG - Intergenic
1168958940 20:1855109-1855131 GAGGCCAGGAGTGATGGAGCTGG + Intergenic
1169524684 20:6411058-6411080 GAGGCTGGGAAGGATGGGGCAGG + Intergenic
1169901833 20:10561376-10561398 AAGACTAGGAAGGATGGGGAAGG - Intronic
1169939971 20:10926336-10926358 GATGAAAGGAAGGATGGTGGTGG - Intergenic
1170236564 20:14112205-14112227 GAGGCTGGGAAGGGTAGTGGGGG + Intronic
1170605040 20:17869602-17869624 GAGGAAAGGAGGGATGGTGCAGG - Intergenic
1171307440 20:24118518-24118540 GAGGCTGGCATGGATGGTGTGGG + Intergenic
1171987400 20:31670193-31670215 GAGGCTAGCTAGGATGGAGAGGG - Intronic
1172040184 20:32039001-32039023 GAGTCTAGGAATGAATGTGCAGG - Intergenic
1172255577 20:33514506-33514528 GAGGCTAGCATGGCTGGAGCAGG + Intronic
1172454007 20:35051954-35051976 GAGGAAAGGAAGGATTGTGATGG - Intronic
1172556831 20:35849452-35849474 GAGGCAGGGCAGGATGGTGCAGG + Intronic
1173553214 20:43947852-43947874 CTGGCTGGGAAGGAAGGTGCTGG + Intronic
1173597394 20:44267786-44267808 GAGGCTAGGGTGGATGGTTCTGG + Intronic
1174288823 20:49492321-49492343 GAGGCTGGGAAGGGTAGTGAGGG + Intergenic
1174362995 20:50040157-50040179 GAGGCTAAGAGGCAAGGTGCGGG + Intergenic
1175027861 20:55921828-55921850 GAAGTTAGGAAGGATGCTGGGGG - Intergenic
1175364991 20:58447022-58447044 GAGCCTAGGGAGGATGCCGCTGG + Exonic
1175527791 20:59647458-59647480 GAGGTTGGGGAGGGTGGTGCAGG + Intronic
1175730719 20:61352144-61352166 GAGGCTGGGAAGGGTAGTGAGGG - Intronic
1175759225 20:61550045-61550067 GAGGCCAGGGAGGTTGGGGCAGG - Intronic
1176017694 20:62944450-62944472 GAGGCTTGTGAGGAGGGTGCTGG + Intronic
1176051208 20:63120650-63120672 GAGGTCAGGAAGGGGGGTGCAGG - Intergenic
1176383214 21:6124039-6124061 GGGGTAAGGATGGATGGTGCCGG - Intergenic
1177106194 21:16958477-16958499 GCTGTTAGGAAGCATGGTGCTGG + Intergenic
1177857025 21:26411171-26411193 GGAGCTAAGAAGGATGGTGGTGG - Intergenic
1178003275 21:28188474-28188496 GATGCTAGGAAGGGTACTGCGGG - Intergenic
1178004577 21:28203529-28203551 GAGGCTGGGAAGGGTAGTGAGGG + Intergenic
1178432379 21:32528097-32528119 GAGGCTGGGAAGGGTAGTGCAGG + Intergenic
1178495233 21:33080659-33080681 GAAGCTAGGAAGGGTGGGACAGG - Intergenic
1178934735 21:36851512-36851534 GAGGCTGGGAAGGGTAGTGGGGG + Intronic
1179740253 21:43414200-43414222 GGGGTAAGGATGGATGGTGCCGG + Intergenic
1179963988 21:44789953-44789975 GAGGCTGGGAAGTCTGGTGAGGG - Intronic
1180667782 22:17528401-17528423 GAGGCTGGGAACGATAGTGGAGG + Intronic
1181064132 22:20297716-20297738 GAGGAGAGGAAGGAGGGTGTGGG + Intergenic
1181319678 22:21994854-21994876 GAGGCGAGGCGGGCTGGTGCTGG - Intergenic
1181412984 22:22737994-22738016 GAGGAGATGGAGGATGGTGCAGG + Intronic
1181771022 22:25125668-25125690 GGGGATGGGAAGGATGGTGCAGG - Intronic
1181848343 22:25731316-25731338 GAGGCTAGGAAGGGTAGTATGGG - Intergenic
1182164541 22:28160051-28160073 GAGGCTGGGAAGGGTAGTGGGGG + Intronic
1182546435 22:31079424-31079446 TAGGCTAGGAGGAATGGTACAGG - Intronic
1182683910 22:32105730-32105752 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
1183034851 22:35133864-35133886 GAGGCTGAGAGGGATGGAGCAGG + Intergenic
1183061399 22:35338493-35338515 GAGGTTAGGGAGGGTGTTGCTGG - Intronic
1183230432 22:36578677-36578699 GAGGCCAGGAAGGGTGGCTCTGG + Intronic
1183786018 22:40029683-40029705 GAGGCCAGGACGGAGGCTGCAGG - Exonic
1184434153 22:44459891-44459913 GAGGCCTGGAAGGAGGGTCCAGG - Intergenic
1184703336 22:46192966-46192988 GAGGCTGGGAAGGGTGGTGAGGG + Intronic
1184729869 22:46366207-46366229 GAGGCGGGGAGGGAAGGTGCGGG + Intronic
1185008199 22:48298188-48298210 GAGGCCAGGGAGGGTGGGGCAGG + Intergenic
1185259800 22:49854971-49854993 GAGGCTAGGAAGGATTTGGTTGG + Intronic
1185298230 22:50064669-50064691 GCTGCTAGGAAGGAAGGGGCAGG + Intronic
949720584 3:6985354-6985376 GAGGCTGGGAAGGGTAGTGGAGG - Intronic
949921084 3:9001073-9001095 GAGGCTAGGAAGGAAGGGGAGGG + Intronic
950733445 3:14983244-14983266 GAGGCTAGGAAGGGTAGTGGCGG - Intronic
951263143 3:20535655-20535677 GAGGCTGGGAAGGGTTGTGGAGG - Intergenic
951809482 3:26683593-26683615 GAGGTTAGGAAGGCTGTGGCTGG + Intronic
951828523 3:26897304-26897326 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
952549118 3:34456026-34456048 GAGGCTAGGAAGAATAGTAGGGG - Intergenic
952853350 3:37747544-37747566 GAGGCTGGGAAGGATAATGGGGG - Intronic
953004613 3:38966758-38966780 GAGGCTGGGAAGGATGTGGAGGG - Intergenic
953177374 3:40564249-40564271 GAGGCTGGGAAGAGGGGTGCAGG - Intronic
954467224 3:50662794-50662816 TAGGCTAGGAAGGATGAATCAGG + Intergenic
956227517 3:66976273-66976295 CTGGATAGGAAGCATGGTGCTGG - Intergenic
956237449 3:67090020-67090042 GAGGCTAGGAAGGGTAGTGGAGG + Intergenic
956938839 3:74134083-74134105 GAGCCTAGGAAGGGTAGTGAGGG + Intergenic
956967351 3:74477568-74477590 GAGGCTGGGAAGGGTAGTGGGGG + Intronic
957147261 3:76440471-76440493 GAGTCTAGGAAGCATGGTCAGGG + Intronic
957280495 3:78145169-78145191 GAGGCTAGAAAGGGTAGTGGGGG - Intergenic
957486025 3:80864328-80864350 GAGGCTGGGAAGGGGAGTGCAGG + Intergenic
957650641 3:82998118-82998140 GAGGCTTTGAAGTATGGTACGGG + Intergenic
957803130 3:85111601-85111623 GAGGCTGGAAAGGATGGTATAGG + Intronic
957846545 3:85744198-85744220 GAGGCTAGGAAAGGTAGTGGGGG + Intronic
958043582 3:88255312-88255334 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
958084562 3:88789758-88789780 TAGGCTGGGAAGGATAGTGAGGG - Intergenic
958175728 3:89993797-89993819 GAGGCTGAGAAGAATAGTGCAGG + Intergenic
958668658 3:97174032-97174054 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
958735756 3:98007634-98007656 AAGGAGAGGAATGATGGTGCTGG + Intronic
958872985 3:99583145-99583167 GAGTCTAGGAAGGGTAGTGGGGG + Intergenic
959244978 3:103854550-103854572 GAAGCTGGGAAGGATAGTGGAGG + Intergenic
959594966 3:108119843-108119865 GAGGCTGGGAAGGGTGGGGTGGG + Intergenic
959612242 3:108308159-108308181 GAGGCTGGGAAGGGTAGTGGTGG - Intronic
959784517 3:110277655-110277677 GAGTCTAGGAATGGTGGTGGTGG - Intergenic
959806123 3:110555924-110555946 GAGGTTATGAAGGGTGGTGAAGG - Intergenic
959913512 3:111791978-111792000 GAGGCTGGGAAGGCTGGTTAGGG - Intronic
960059046 3:113300204-113300226 GAGTCTGGGAAGGATAGTGGAGG + Intronic
960235515 3:115277581-115277603 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
960378331 3:116930118-116930140 GATGGCAGGCAGGATGGTGCGGG + Intronic
960540895 3:118861364-118861386 GAGGCTGGGAAGGGTAGTGGTGG - Intergenic
960989578 3:123301824-123301846 GAGGCTAGGGAGGCTGGGGAGGG + Intronic
961537807 3:127580520-127580542 GAGGACAGGAAGGAAGGGGCAGG - Intronic
961676993 3:128573658-128573680 GAGTCTAGGCAGGCTCGTGCTGG + Exonic
961771339 3:129252379-129252401 GCGGGTAGGGAGAATGGTGCTGG + Intronic
962077432 3:132097653-132097675 GAGGCTGGGAAGGGTAGTGAGGG + Intronic
962139688 3:132776098-132776120 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
962758112 3:138483745-138483767 GAGGCTGGAAAGGATAGTGGGGG - Intergenic
963201048 3:142586081-142586103 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
963228165 3:142884018-142884040 GAGCCCATGAAGCATGGTGCTGG - Intronic
963359595 3:144253808-144253830 GAGGCTGGGAAGGATAGTAGGGG - Intergenic
963480138 3:145862265-145862287 GAGGCTGGGAAGGATTGTGTAGG - Intergenic
963802888 3:149695152-149695174 GAGGCTGGGAAAGATAGTGAAGG + Intronic
964180164 3:153874055-153874077 GAGGCTGGGAAGTATAGTGGGGG + Intergenic
964208287 3:154199210-154199232 GAGGCTAGGAAGGGTAGTCGGGG - Intronic
964728447 3:159839684-159839706 GTGGGTAGGAAGGATGATGCCGG + Intronic
964763165 3:160153401-160153423 GAGGCCAAGAAGGATGGAGAAGG - Intergenic
965006774 3:163037068-163037090 GAGGTGAGGAAGAATGGTTCTGG + Intergenic
965032420 3:163390055-163390077 GAGGCTAGGAAGTATGTAGATGG + Intergenic
965152852 3:165004795-165004817 GAAGCTAGGAAGGGTTGTGTGGG + Intronic
965348856 3:167588101-167588123 GAGGCTGGGAAGGGTAGTGGTGG - Intronic
965605032 3:170489935-170489957 GAGGCTGGGAAGGATAGTTGGGG + Intronic
966235550 3:177697894-177697916 GAGGCTGGGAAGGATAGTCGGGG + Intergenic
966349045 3:179011217-179011239 GAGGCTGGGAAGGGTAGTGAGGG + Intergenic
966842895 3:184103853-184103875 GAGGAAAGGAAGGAAGGAGCTGG + Intronic
966886148 3:184379193-184379215 AAGATTAGGAAGGAGGGTGCTGG + Intronic
967632624 3:191763707-191763729 GAGGCTGGGAAGGGTAGTGGAGG - Intergenic
967696398 3:192536946-192536968 GAGGCTAGGAAGTGTAGTGGCGG - Intronic
968964507 4:3763213-3763235 GGGGCGAGGAAGGAGGGTGCTGG - Intergenic
969100333 4:4763665-4763687 GCGGCTAGGAAGGAGGCAGCAGG - Intergenic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
969665237 4:8553568-8553590 GTGGCTAGAAGGGAGGGTGCAGG + Intergenic
970404563 4:15749985-15750007 GAGGCTGGGAAGGGTAGTGAGGG - Intergenic
970626978 4:17896871-17896893 GAGGCTGAGAAGGATAGTGGGGG - Intronic
971171985 4:24242842-24242864 GAGGCTGGGAGGGATGGTGAGGG - Intergenic
971523168 4:27581254-27581276 GAGGCTGGGAAGGATAGTGGGGG - Intergenic
971558494 4:28043808-28043830 GAGGCTGGGAAGGGTAGTGGAGG - Intergenic
972242419 4:37207639-37207661 GAGGCTGGGAAGGGTAGTGGTGG - Intergenic
972876821 4:43372570-43372592 GAGGCTTGGAAGGGTAGTGAGGG - Intergenic
972988022 4:44789269-44789291 GAGGCTAGGAAGAGTAGTGGGGG - Intergenic
973181768 4:47277356-47277378 GAGGCTCGGAAGGATAGTGAGGG + Intronic
973227700 4:47804707-47804729 GAGGCTGGGAAGGATGGTGGGGG + Intronic
973762162 4:54127654-54127676 GAGGCTGGGAAGGGTAGTGAGGG - Intronic
973812046 4:54581064-54581086 GAGGTGAGGAAGGATTCTGCTGG + Intergenic
973906455 4:55536615-55536637 GTGTATAGGAAGCATGGTGCCGG - Intronic
974728466 4:65828297-65828319 GAGGCTAGGAAGAATAATGAAGG - Intergenic
975521438 4:75305844-75305866 GAGAGAAGGAAGGATGCTGCAGG + Intergenic
975540027 4:75499764-75499786 AAGGGTAGGGAGGATGGGGCAGG + Intronic
976109399 4:81654998-81655020 GAGGCTGGGAAGGAGAGTGGGGG - Intronic
976117996 4:81748784-81748806 GAGGCTGGGAAGGGTGGTGGGGG - Intronic
976482657 4:85562890-85562912 GAGGTTAGGAAGGGTAGTGAGGG + Intronic
977209858 4:94206486-94206508 GAGGCTGGGAAGGGTAGTGTGGG + Intergenic
977812365 4:101371571-101371593 GAGGCTAGGAACTATAGTGGGGG - Intergenic
978097559 4:104796880-104796902 GAGGCTAGGAAGGACAGTTGGGG - Intergenic
978212238 4:106151356-106151378 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
978400182 4:108322865-108322887 GAGGCTGGGAAGGATAGTAGAGG + Intergenic
978918968 4:114158832-114158854 GAGGCTTGGAAGGGTTGTGAAGG + Intergenic
978933772 4:114350746-114350768 GAGGCTGGGAAGGATAGCGGGGG - Intergenic
979402218 4:120262431-120262453 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
979422527 4:120522969-120522991 GAGGCTGGGAAGGGTAGTGGTGG + Intergenic
980531448 4:134060915-134060937 GAGGCTGGGAAGGATAGTGTGGG + Intergenic
981444291 4:144817800-144817822 GAGGCTGGAAAGGTTGGGGCAGG + Intergenic
981954708 4:150455811-150455833 GAGGCTGGGAAGGGTGGTGAGGG - Intronic
981976227 4:150731685-150731707 GAGGCTAGGAAGGGTAGTGAGGG + Intronic
982427360 4:155280888-155280910 GAGGCTAGAAAGGATGGGTGGGG - Intergenic
983022288 4:162692654-162692676 GAGGCTGGGAAGGGTAGTGAGGG - Intergenic
983421440 4:167523389-167523411 GAGGCTGGGAAGGATAGTTGGGG - Intergenic
983595046 4:169457052-169457074 GAGGCTAGGAAGGGTGGTGGTGG + Intronic
983664694 4:170167839-170167861 GTGGCTCGGACGGATTGTGCCGG + Intergenic
984132973 4:175901117-175901139 GAGGCTGGGAAGGATAGTGGGGG + Intronic
984188861 4:176580639-176580661 GAGGCTGGGAGTGATGCTGCAGG - Intergenic
984586715 4:181572887-181572909 GGGGCTAGGAAGGGTAGTGAAGG - Intergenic
984787862 4:183585428-183585450 GAGGCAAGGAAGGAGGGAGATGG + Intergenic
984875371 4:184363153-184363175 GGGGCTAGGATGGATGGGGCTGG + Intergenic
984951747 4:185013008-185013030 GAGGCCAGGCAAGATGGTTCAGG + Intergenic
985230088 4:187806298-187806320 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
985335672 4:188891052-188891074 GAGGCTGGGAAGGGTTGTTCTGG - Intergenic
985544114 5:500652-500674 GGGGCTAGTATGGATGGGGCTGG + Intronic
985662548 5:1164331-1164353 GTGGGTGGGAAGGATGGTGTGGG + Intergenic
985744310 5:1637723-1637745 GAGGCTAGGAACCATGCTGGAGG - Intergenic
985783975 5:1884816-1884838 GAGGGGAGGAAGGAGGGTGGGGG - Intronic
986866604 5:11996502-11996524 GAGGCTGAGAAGGGTAGTGCAGG - Intergenic
986967977 5:13298526-13298548 GAGGCTGGGAAAGGTAGTGCAGG + Intergenic
986991496 5:13558208-13558230 GAGGCTGGGAAGGGTGGAGGAGG - Intergenic
986996032 5:13608339-13608361 GAGGCTAGGAAGGGTAGTTGGGG + Intergenic
987000610 5:13655894-13655916 GGGTCTTGGAAGGAGGGTGCAGG - Intergenic
987564554 5:19567073-19567095 GAGGCTAGGAAGGGTAGTGGTGG + Intronic
987585817 5:19854878-19854900 GAGGCTGGAAAGGATAGTGGGGG - Intronic
987612275 5:20221458-20221480 GAGGCTAGGAAGTGTAGCGCGGG + Intronic
987617226 5:20291955-20291977 GAGGCTAGGAAGGAAATTACGGG - Intronic
987631951 5:20484792-20484814 GAGGCTGGGAAGGGTAGTGGCGG + Intronic
987681902 5:21146642-21146664 GAGGCTGGGAAGGGTAGTGCGGG - Intergenic
988249722 5:28740909-28740931 GAGGCTGGAAAGGATAGTGAGGG - Intergenic
988300185 5:29414215-29414237 GAGGCTGGGAAGGATAGTGGAGG - Intergenic
988322556 5:29718078-29718100 GAAGCTGGGAAGGATAGTGAGGG + Intergenic
989330324 5:40250768-40250790 GAGGCTGGGAAGAGTGGTGGGGG + Intergenic
989553752 5:42766752-42766774 GAGGCTGGGAAGGGTAGTGGGGG + Intronic
989630030 5:43472787-43472809 GAGGCTGTGAAGGGTGGTGGGGG + Intronic
989741227 5:44774921-44774943 GAGGCTAGGAAGCATAGTGGGGG - Intergenic
990700466 5:58469624-58469646 GAGGCTACGAAGGGTAGTGGGGG - Intergenic
991331098 5:65492997-65493019 GAGGCTGGGAAGGATAGTGGGGG + Intergenic
992044486 5:72871661-72871683 GAGTCTATGAAAGATGGTGAAGG + Intronic
992483280 5:77171973-77171995 AAAGCTAGAAAGGATTGTGCTGG - Intergenic
992748329 5:79840066-79840088 GAGGTTGGGGAGGAAGGTGCTGG - Intergenic
993953874 5:94208668-94208690 GAGGATGGGAAAGATGGAGCTGG + Intronic
993987893 5:94618862-94618884 GAGGCTAGGAAGGAAGCGGCTGG + Intronic
994766870 5:103929405-103929427 GAGGCAAGGGAGAATAGTGCAGG + Intergenic
995572643 5:113496593-113496615 GAGGCTGGGAAGGATAGTTGGGG - Intergenic
995685641 5:114769041-114769063 GAGGCTGGGAAGGGTAGTGAGGG - Intergenic
995771051 5:115670652-115670674 GAGGCTGGGAAGGGTAGTGGAGG + Intergenic
995847467 5:116509628-116509650 GCGATTAGGAAGGATGGTACAGG + Intronic
996459969 5:123730950-123730972 GAGGCTGGGAAGGGTAGTGCAGG + Intergenic
996796195 5:127350987-127351009 GAGGATGGGAAGGATAGTGGGGG + Intronic
996969954 5:129353908-129353930 CAGGCTGGGAAGGATGGTGGGGG + Intergenic
997417067 5:133737252-133737274 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
997721408 5:136080813-136080835 GAGGGGAGGCAGGAGGGTGCGGG + Intergenic
997870757 5:137503307-137503329 GAGGCCAGGAAGGGTAGTGGAGG - Intronic
998670301 5:144346002-144346024 GAGGCTAGGAAGGGTAATGAGGG - Intronic
998698037 5:144663278-144663300 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
999379567 5:151110697-151110719 GAGGTTGGGGAGGCTGGTGCTGG + Intronic
1000452326 5:161405154-161405176 GAGGCTAGGAAGGATGGCAGTGG - Intronic
1001326046 5:170725509-170725531 GAGGCTGGGAAGGATAGTAGGGG + Intronic
1002847813 6:963568-963590 GAGGCTAGGCAGGCTCGTCCTGG + Intergenic
1003084279 6:3049068-3049090 GAGGCCAGGGAGGAAGGCGCAGG + Intergenic
1003215110 6:4102168-4102190 GAGGCTGGGAAGGGTAGTGGAGG + Intronic
1003708541 6:8562647-8562669 GAGGCTAGGAAGGGTAGTGGGGG + Intergenic
1005280333 6:24267149-24267171 GAGGCTGGGAAGGGTAGTGAGGG + Intronic
1005421065 6:25651864-25651886 GAGGCGAGAAGGGATGGTGATGG - Intergenic
1005519633 6:26588334-26588356 GAGGCTCGGAAGGCTGAGGCAGG - Intergenic
1005907564 6:30277764-30277786 GAGGCTAGGAATGGTAGTGGGGG - Intergenic
1005926429 6:30449392-30449414 GTGGCTAGGAAGGATTGAGAGGG + Intergenic
1005948157 6:30610227-30610249 CATCCTAGGAAGGATGCTGCTGG - Intronic
1005975027 6:30791334-30791356 AAGGTTAGGGAAGATGGTGCAGG - Intergenic
1006110038 6:31738951-31738973 GAAGTTAGGAAAGATGGTGGGGG - Intronic
1006249424 6:32768731-32768753 GAGGATGGGAAGGAGGGTGAAGG - Intergenic
1006416495 6:33907307-33907329 GAGGCTGGGGAGGAGGGTCCAGG + Intergenic
1006453741 6:34120371-34120393 GAGGCAAGGAAGGCAGGTGAGGG + Intronic
1006593348 6:35174113-35174135 GAGGCAAGGAAGGCAGGGGCAGG + Intergenic
1007453056 6:41954678-41954700 GAGGCTAGGCACGATGGCTCAGG - Intronic
1007617126 6:43186723-43186745 GAGGCTAGGAAGGAATGTCGAGG + Intronic
1008456310 6:51715068-51715090 GGGGTTAGGAAGGATGGAGATGG - Intronic
1008488401 6:52059547-52059569 GAGGCTTGGAAAGATTGTGTGGG - Intronic
1009822441 6:68820644-68820666 GAGGCTGGGAAGGACGGTGGAGG - Intronic
1009823926 6:68841857-68841879 GAGGCTAGGAAGGGTAGTGAGGG + Intronic
1010048065 6:71470520-71470542 GAGACTAGGAAGGGTGGGGAGGG - Intergenic
1010067450 6:71700957-71700979 GAAGCTAGCAAGGTTGGTGCAGG + Intergenic
1010557455 6:77301661-77301683 GAGACTGGGAAGGATAGTGGGGG - Intergenic
1010839361 6:80629991-80630013 GAGGCTAGGAAGGGTAGTGGGGG + Intergenic
1011344043 6:86349346-86349368 GAGGCTGGGAAGAATAGTGGAGG + Intergenic
1011385463 6:86792941-86792963 GAGGCTGGGAAGGATAGTCGGGG - Intergenic
1012522972 6:100143056-100143078 GAGGATGGGAAGGTTGGTGGTGG + Intergenic
1012755193 6:103221750-103221772 GAGGCTGGGAAAAATGATGCAGG - Intergenic
1013257036 6:108397612-108397634 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
1013482512 6:110564689-110564711 GATGGTAGGAAGGATGGGGGGGG - Intergenic
1013844225 6:114430005-114430027 TAGGCTAAGAGGAATGGTGCTGG + Intergenic
1013958998 6:115875284-115875306 GATGCTAGAAAGGATGGGGACGG - Intergenic
1014060498 6:117066058-117066080 GAGGTTAGGAAGGGTAGTGGGGG - Intergenic
1014077588 6:117253768-117253790 GAGGCTGGGAAGGGTGGTGGAGG - Intergenic
1014093057 6:117427183-117427205 GAGGCTGGGAAGGGTGGTGGTGG - Intronic
1014331356 6:120069200-120069222 GAGGCTAGGAAGGGTAGTTGCGG - Intergenic
1014701063 6:124688635-124688657 GAGGTTAGAAAGGATGGAGGGGG - Intronic
1015918732 6:138245434-138245456 GAGGATGGGAAGGATGGTTCAGG + Intronic
1016116777 6:140296160-140296182 GAGGCAGGGAAGGATGTAGCAGG + Intergenic
1016456875 6:144240077-144240099 GAGGCTGGGAAGGATAGTGAAGG - Intergenic
1016762503 6:147753705-147753727 GAGGCTGGGAAGGGTGGTGAGGG - Intergenic
1016897849 6:149071197-149071219 GAGGCTAAGAAGGGTAGTGGGGG - Intronic
1017018622 6:150121824-150121846 GAGGCTAGGAAGTGTAGTGAGGG - Intergenic
1017114070 6:150960352-150960374 ACGGCTGGGAAGGATGGTGGTGG + Exonic
1017388212 6:153909959-153909981 GAGGCTGGGAAGGGTAGTGTGGG + Intergenic
1017812301 6:157992271-157992293 GAGGCTAGGAAGGGTAGCGGCGG - Intronic
1018742686 6:166742633-166742655 GTTGCTGGGAAGGATGCTGCAGG - Intronic
1018875143 6:167815775-167815797 GAGGCAAGGAAAGACGGGGCTGG + Intergenic
1019635993 7:2076008-2076030 GAGGCCAGGACAGGTGGTGCTGG + Intronic
1019843064 7:3468663-3468685 GAGGCCAGGAAGAATCCTGCTGG + Intronic
1020041703 7:5008404-5008426 GAGGCTGGGAAGGGTAGTGGAGG - Intronic
1020125072 7:5529110-5529132 GAGGCCAGGAAGGAGGGAGGCGG + Intronic
1020664025 7:11016896-11016918 GACGTTGGGAAGGATAGTGCAGG - Intronic
1020895459 7:13933540-13933562 GAGGAAAGGAAGCAGGGTGCAGG + Intronic
1021101388 7:16588383-16588405 GAGGCTGGGGAGGCTGGGGCAGG + Intergenic
1021384156 7:20007760-20007782 GACTGTAGGAAGCATGGTGCTGG + Intergenic
1021746970 7:23751026-23751048 GAGGCTAGGAAGGATGTGGTAGG - Intronic
1021956355 7:25828814-25828836 GAGGCTGGGAAGGGTAGTGTGGG + Intergenic
1021965745 7:25916298-25916320 GAGGCTAAGAGGGGTGGTGTAGG - Intergenic
1022040860 7:26579971-26579993 GTGGCTGGGAGAGATGGTGCGGG + Intergenic
1022080928 7:27020310-27020332 GAGGCTGGGAAAGATAGTGGGGG + Intergenic
1022405464 7:30085851-30085873 GTGGAGAGGAAGGATGGTGTAGG + Intronic
1022508883 7:30922852-30922874 GAGGCCAGGCAGCATGGGGCAGG - Intronic
1022610025 7:31861706-31861728 TGGACTAGGAAGGATGCTGCTGG - Intronic
1022663664 7:32388566-32388588 GATGCTAGAAAGGATGAGGCAGG + Intergenic
1022929921 7:35100553-35100575 GAGGCTGGGAAGGATAGTGAGGG + Intergenic
1023256829 7:38320661-38320683 GAGGCTTGTAAGGGTGGTGGGGG - Intergenic
1023622024 7:42083191-42083213 GAGGCTAGGAAGGATAGTGGGGG - Intronic
1024616928 7:51123605-51123627 GAGGCTGTGAATGATGGAGCAGG + Intronic
1024956995 7:54932965-54932987 GAGGCTAGGAAGGGTAGTGGGGG + Intergenic
1025060384 7:55800677-55800699 GAGGCTGGGAAGGGTGGTAGGGG + Intronic
1025065677 7:55853521-55853543 GAGGCTAAGAAGGGTAGTGGGGG + Intronic
1025952359 7:66155409-66155431 GAGGCTAGGAAGGGTAGTGGGGG + Intergenic
1026031902 7:66801537-66801559 GAGGCTGGGAAGGGTAATGCAGG - Intronic
1026072917 7:67138623-67138645 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
1026583745 7:71638924-71638946 GAGGCTGGGAAGGGTAGTGGGGG + Intronic
1026663497 7:72322655-72322677 GAGGCTGGGAAGGGTAGTGGGGG + Intronic
1026703963 7:72673593-72673615 GAGGCTGGGAAGGGTAGTGGGGG + Intronic
1026838078 7:73651396-73651418 GAAGATAGGAAGTAGGGTGCAGG + Intergenic
1028280818 7:88925749-88925771 GAGAGTAGAAAGGATGGTGCAGG + Intronic
1028405895 7:90473381-90473403 GAGGCTAGCAAGGAAGGAGGAGG + Intronic
1028503330 7:91543335-91543357 GAGGCTAGGAAGGGTAGTTGGGG + Intergenic
1028521209 7:91733183-91733205 GAGGCTGGGAAGGGTGTTGCAGG - Intronic
1028722445 7:94049035-94049057 GAGGCTAGGAAGGGTAGTGGAGG + Intergenic
1029055033 7:97732758-97732780 GAGCCCAGGAAGAAGGGTGCGGG - Intronic
1029246188 7:99203620-99203642 GTGGCTAGGATAGATGGTGTTGG + Intronic
1029317338 7:99726539-99726561 GAGGCTGGGATGTGTGGTGCAGG - Intronic
1029825815 7:103192997-103193019 GAGGCTGGGAAGGATAGTGAGGG + Intergenic
1030355169 7:108534014-108534036 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
1030369124 7:108677057-108677079 GAGGTTAGGAAGGGTGGAGTGGG - Intergenic
1030662974 7:112241845-112241867 GAGGCTGGGAAGGGTAGTGGTGG + Intronic
1030679445 7:112419361-112419383 GTGGCTAGGAAGGGTAGTGGGGG + Intergenic
1030872505 7:114774563-114774585 GAGGCTAGGAGGGGTAGTGGGGG + Intergenic
1030883383 7:114909400-114909422 GAGGCTGGGAAGGGTAGTGATGG - Intergenic
1031078414 7:117234735-117234757 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
1031306734 7:120137362-120137384 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1031311658 7:120206892-120206914 GCTACTAGGGAGGATGGTGCAGG - Intergenic
1031501445 7:122522730-122522752 GAGGCTGGGAAGGGTGTTGGGGG - Intronic
1031755682 7:125638891-125638913 GAGGGTAAGAGGGATGATGCTGG - Intergenic
1032220124 7:129988156-129988178 GAGGCGAGGAAGGATGGGGAAGG + Intergenic
1033480587 7:141736357-141736379 GGGGCTAGGAAGGTTAGTGGGGG - Intergenic
1033509202 7:142038051-142038073 GAGGCTGGGAAGGGTAGTGAGGG - Intronic
1033584237 7:142762424-142762446 GAGGCTGGGAAGGAGGGTTAAGG + Intronic
1034019341 7:147625099-147625121 GAGGCTGGGAAGGGTAGTGAGGG + Intronic
1034247155 7:149654957-149654979 GAGGCTAGGAATGATAGTGGGGG + Intergenic
1034558941 7:151867383-151867405 GAGGCAAGGAAGGATCCTCCCGG - Intronic
1034990031 7:155542388-155542410 GAGCCAAGGAAGGAAGGTCCTGG + Intergenic
1035010461 7:155711301-155711323 GAGGCGGGGATGGGTGGTGCGGG - Exonic
1035910044 8:3556283-3556305 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
1036288013 8:7461907-7461929 GAGGTTGGGTAGGATGCTGCAGG + Intronic
1036333463 8:7849621-7849643 GAGGTTGGGTAGGATGCTGCAGG - Intronic
1036521271 8:9493912-9493934 GAGGGTGGGGAGGAGGGTGCTGG - Intergenic
1036544829 8:9757568-9757590 GGGGCTGGGAAGGAAGGAGCAGG - Intronic
1037358228 8:18045639-18045661 AAGGATAGGAAGAAGGGTGCTGG + Intergenic
1037484394 8:19333832-19333854 AAGGCCAGGAAGGAAAGTGCAGG + Intronic
1037559148 8:20056213-20056235 GAGACTGGGAAGGGTGATGCAGG + Intergenic
1038765474 8:30423757-30423779 GAAGAAAGGCAGGATGGTGCGGG + Intronic
1038892901 8:31747003-31747025 GAGGCTGGGAAGGGTAGTGGGGG + Intronic
1039042280 8:33419063-33419085 GAGGCTGGGAAGGTTGGGGGTGG + Intronic
1039071771 8:33655421-33655443 GAGGCTGGGAAGGGTGGTGGAGG - Intergenic
1039093739 8:33860154-33860176 GAAGCTAAGAAGGCTGATGCTGG - Intergenic
1039610652 8:38916412-38916434 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
1039614801 8:38946805-38946827 AAGGGTAGGAAGGATGGAGAGGG + Intronic
1039615444 8:38951587-38951609 GAGCCTAGGAAGGCTGAGGCAGG - Intronic
1039650588 8:39336986-39337008 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
1040362146 8:46676070-46676092 GAGGCTGAGAAGGGTGGTGGGGG + Intergenic
1040363393 8:46689231-46689253 GAGGCTAAGAAGGGTAGTGGGGG - Intergenic
1041626735 8:60037792-60037814 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1042082001 8:65064477-65064499 GAGGCTAGGAAGGGTAGTTGGGG - Intergenic
1042358485 8:67855345-67855367 GAGGCTGGGAAGGGTAGTGGAGG + Intergenic
1042853759 8:73243149-73243171 GAGGCTGGGAAGGATAGTGGAGG + Intronic
1043554689 8:81417434-81417456 GAGGCTGGGAAGGGTAGTGAGGG + Intergenic
1043557608 8:81450608-81450630 GAGGCTGGGAAGGGTAGTGCAGG - Intergenic
1043567884 8:81568954-81568976 AAGGCTAAGAAGGGTGGTGGTGG + Intergenic
1043722677 8:83565600-83565622 GAAGATGGGAAGGATAGTGCGGG - Intergenic
1044957540 8:97496956-97496978 GAGGCTAGGAAGTACAGTGCTGG + Intergenic
1045918099 8:107497566-107497588 GAGGCACGGAAGGAGTGTGCTGG - Exonic
1046077047 8:109325187-109325209 GAGGCTGGGAAAGATGGGGGTGG + Intronic
1046166494 8:110443254-110443276 GAGGCTAGGAAGGGTAGTTGGGG - Intergenic
1046345604 8:112922525-112922547 GAGGCTGGGAAGGTTAGTGGGGG - Intronic
1046859472 8:119074140-119074162 GAGGCTAGGAAGGGGAGTGGGGG + Intronic
1046882848 8:119329363-119329385 GAGGCTGGGAAGGGTGGGGCAGG + Intergenic
1047007474 8:120635543-120635565 GAAGTTAGGAAAGATGGTGGAGG - Intronic
1047076550 8:121410849-121410871 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
1047295040 8:123563208-123563230 GAGTCTAGTGAGGATGCTGCTGG + Intergenic
1047382833 8:124379739-124379761 GAGGCTAGGAAGGGTAGTGTGGG - Intergenic
1047431905 8:124800046-124800068 GAAGCAGGGAAGGAGGGTGCTGG - Intergenic
1047934141 8:129760200-129760222 GAGACTGGGAAGGGTGGTGGGGG + Intronic
1048060366 8:130913337-130913359 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
1048884889 8:138902052-138902074 GACGCTGTGAAGGATGCTGCAGG + Intronic
1049844305 8:144792593-144792615 TGGGCTCGGAAGGAGGGTGCAGG + Intergenic
1049848396 8:144816763-144816785 GAGGCTAGGAAGGATGGGGTGGG + Intergenic
1050087919 9:1985838-1985860 GAGGCTGGGAAGGGTAGTGGCGG - Intergenic
1050137771 9:2485489-2485511 GAGACTGGGAAGGGTAGTGCGGG + Intergenic
1050578117 9:7020956-7020978 GAGGCTAGGAAGGGTGGTGGGGG - Intronic
1051230058 9:14946693-14946715 GAGTCTAGGAAGGGTAGTGGGGG + Intergenic
1051345717 9:16149013-16149035 GAGGCTGGGAAGGGTAGTGGTGG - Intergenic
1051432713 9:16996577-16996599 GAGGCTGGGAAGGGTAGTGGAGG + Intergenic
1051582339 9:18690769-18690791 GAGGCCAGAAAGGAAGGTGTTGG - Intronic
1051815792 9:21103888-21103910 GAGGCTAGGAAGGGTAATGGGGG + Intergenic
1052733317 9:32314991-32315013 GAGACTGGGAAGGGTGGTGGGGG + Intergenic
1052812146 9:33070862-33070884 GAGGCTGGGAAGGGTGGAGGTGG + Intronic
1052927972 9:34033458-34033480 GAGGCTAGGAAGGGTAGTGGGGG + Intronic
1053009918 9:34627298-34627320 GAAGGTAGGCAGGGTGGTGCTGG + Intronic
1053464503 9:38295821-38295843 GAGGGTGGGCAAGATGGTGCAGG - Intergenic
1054854909 9:69888592-69888614 GAGGCTAGGCAGGGTGGCTCAGG + Intronic
1054909254 9:70438842-70438864 GAGGCTGGGAAGGAAGGTTCTGG + Intergenic
1055419233 9:76119947-76119969 GAGGCTGGGAAGGGTGGTGATGG - Intronic
1055668325 9:78574326-78574348 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
1055827739 9:80347196-80347218 GAGGTTAGGAAGGGTAGTGGTGG + Intergenic
1056180529 9:84078186-84078208 GAGGCTGGGAAGGGTAGTGAGGG + Intergenic
1056252570 9:84765049-84765071 GAGGCTGGGAAGGGTAGTGAGGG + Intronic
1056697201 9:88869681-88869703 GAGGCTGGGAAGGGTAGTGAGGG + Intergenic
1056815653 9:89799014-89799036 GATGCTGGGAAGGAAAGTGCAGG + Intergenic
1057064721 9:92038117-92038139 GAGGGTAGAAAGGAAGATGCTGG - Intronic
1057478811 9:95427686-95427708 GAGGCTGGGAAGGGGAGTGCGGG + Intergenic
1057970059 9:99546223-99546245 GAGGCTGGGAAGGGTAGTGGAGG - Intergenic
1058248356 9:102659479-102659501 GAGGCTAGGAAGGGTAGTGGGGG + Intergenic
1058315017 9:103554374-103554396 GATGCTGGTGAGGATGGTGCTGG - Intergenic
1058842933 9:108927881-108927903 GAGGCTGGGAAGGGTAGTGAGGG + Intronic
1059140171 9:111845678-111845700 GAGGCTGGGAAAGGTAGTGCAGG - Intergenic
1059183221 9:112239879-112239901 GAGGCAAGGAAGGATCGATCAGG + Intronic
1059205190 9:112457887-112457909 AGGGCTAGTAAGGATGGTGTTGG - Intronic
1059295331 9:113265243-113265265 GAGACTAGGAATGGTGGTGATGG - Intronic
1059500094 9:114745039-114745061 GAGGCTGGGAAGGGTAGTGGAGG - Intergenic
1059930280 9:119253592-119253614 GAGGCTGGGAAGGATAGTTGGGG + Intronic
1060227634 9:121804099-121804121 GAGGCTGGGAAGGGTGTTGAGGG - Intergenic
1060227800 9:121806067-121806089 GAGGCTGGGAAGGGTGTTGAGGG + Intergenic
1060423542 9:123486483-123486505 GAGGCCAGGAAGGAAGCAGCTGG + Intronic
1060762771 9:126270050-126270072 GAGGCTGGGAAGGGTAGTGTAGG + Intergenic
1060856399 9:126917083-126917105 GGGGCCAGGAACCATGGTGCTGG + Intronic
1060888730 9:127174920-127174942 GAGCCTGGGCAGGCTGGTGCAGG - Intronic
1060899879 9:127247926-127247948 GAGGCTGGGAAGGATAGTAGGGG - Intronic
1061789647 9:133052301-133052323 GTGGGTAGGAAGGATGGGCCAGG - Intronic
1062101486 9:134730837-134730859 GTGGCCAGGCAGGATGGGGCTGG + Intronic
1062607070 9:137353187-137353209 GAGGCCAGGAGGGCTGGTGGAGG - Intronic
1185720880 X:2380467-2380489 GAGTCTAGCAGGGATGGTTCAGG + Intronic
1186710080 X:12184829-12184851 GAGGCTGGGAAGGGTAGTGGGGG + Intronic
1186899332 X:14036918-14036940 GAGGCTAGGAAGCATAGTGGGGG + Intergenic
1187470805 X:19568089-19568111 GAGGCTGGGAAGGGTAGTACAGG + Intronic
1187472645 X:19582635-19582657 GAGGCCAGCAAGGATGGAGTGGG - Intronic
1187670439 X:21661027-21661049 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
1187727209 X:22215732-22215754 GAGCCTGGGAAGGGTGGTGGGGG - Intronic
1187793100 X:22972130-22972152 GAGGCTGGGAAGGACAGTGTGGG + Intergenic
1187859150 X:23665219-23665241 GAGGCTGGGAAGGGTAGTGGGGG + Intronic
1187884716 X:23878774-23878796 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
1188202629 X:27309832-27309854 GAGGCTGGGAAGGGTAGTGGCGG - Intergenic
1188419124 X:29975026-29975048 GAGGCTGGGAAGGTTAGTGGGGG - Intergenic
1188474761 X:30579546-30579568 GAGGCTGGGAAGGGTAGTGGAGG - Intergenic
1188597084 X:31914724-31914746 GAGGCTGGGAAGGATAGTGGAGG + Intronic
1188745196 X:33832755-33832777 GAGGCTGGGAAGGGTAGTGGAGG - Intergenic
1188788272 X:34375842-34375864 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1188889588 X:35593903-35593925 GAGGCTGGGAAGGGTAGTGAGGG + Intergenic
1188916467 X:35917468-35917490 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1188942916 X:36262366-36262388 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
1189088845 X:38056110-38056132 GAGGCTGGGAAGGGTAGTGGGGG - Intronic
1189577572 X:42370978-42371000 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
1189750641 X:44217689-44217711 GAGGCTAGAAAGGGTAGTGGGGG + Intronic
1189858091 X:45243760-45243782 GAAGCTGGGAAGGGTGGTGGGGG - Intergenic
1189870677 X:45380066-45380088 GAAGCTGGGAAGGGTGGTGTGGG - Intergenic
1189873705 X:45411881-45411903 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
1189913461 X:45834769-45834791 GAGACTGGGAAGGATAGTGGGGG + Intergenic
1190139566 X:47830806-47830828 GAGGCTGGGAAGGATAATGGGGG + Intergenic
1190282389 X:48939637-48939659 GAGGCCAGGAAGGAGGTTGGTGG - Intronic
1190373852 X:49769414-49769436 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
1190615848 X:52230118-52230140 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1190806846 X:53845978-53846000 GAGGCTGGGAAGGCTAGTGGTGG - Intergenic
1191147652 X:57185235-57185257 GAGGCTGGGAAGGGTAGTGCTGG - Intergenic
1191798619 X:65052462-65052484 GAGGCTGGGAAGTAGGGTTCTGG - Intergenic
1192079976 X:68038396-68038418 AAGGCTGAGAAGGATGGTGAGGG + Intergenic
1192137706 X:68619906-68619928 GAGGCTAGGAAGGGTAGTGGAGG - Intergenic
1192381114 X:70617673-70617695 AAGGATGGGAAGGATGGTGGAGG + Intronic
1192484978 X:71517179-71517201 GAGGCTGGGAAGGGTAGTGGAGG + Intronic
1192493896 X:71600967-71600989 GAGGCAGGGAAGGATAGTGGAGG - Intronic
1192725388 X:73745726-73745748 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
1192758220 X:74067742-74067764 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
1192889486 X:75373989-75374011 GAGGCTGGGAAGGGTAGTGGAGG - Intronic
1193112722 X:77745583-77745605 GAGGCTAGGACGGGTAGTGGGGG + Intronic
1193489949 X:82136730-82136752 GAGGCTAGGAAGGCTAGTGAGGG + Intergenic
1193835948 X:86343902-86343924 GAGGCTGGGAAGGGTAGTGGGGG + Intronic
1193931069 X:87552798-87552820 GAGGCTGGGAAGGATAGTGAGGG + Intronic
1194164053 X:90491648-90491670 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1194514547 X:94835647-94835669 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
1194586354 X:95739225-95739247 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1194774792 X:97949063-97949085 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1194891841 X:99388651-99388673 GAGGCTGGGAAGTATAGTGGGGG - Intergenic
1195038971 X:100996258-100996280 GAGGCTGGGAAGGGTGGAGCGGG + Intergenic
1195101357 X:101557211-101557233 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
1195435241 X:104836255-104836277 GAGGCTGGGTAGGATAGTGGGGG + Intronic
1195488951 X:105443498-105443520 GAGGCTAGGAAAGGTAGTGGGGG - Intronic
1195507780 X:105678495-105678517 GAGGCTAGGAAGGGTAATGAGGG - Intronic
1195542503 X:106078773-106078795 GAGGCTGGGAAAGATAGTGGGGG - Intergenic
1195547687 X:106131367-106131389 GAGGCTGGGAAGGGTAGTGGAGG + Intergenic
1195697691 X:107678950-107678972 GAGGTTACCAAGGAAGGTGCTGG + Intergenic
1195825577 X:108996645-108996667 GAGACTGGGAAGGATAGTGGGGG + Intergenic
1195911601 X:109893788-109893810 GAGGCTGGGAAGGATAGTGGGGG - Intergenic
1196003439 X:110810705-110810727 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
1196233015 X:113246699-113246721 GAGGCTGGGATGGATAGTGGGGG - Intergenic
1196248992 X:113435773-113435795 GAGGCTAGGAAAGGTAGTGGGGG + Intergenic
1196286535 X:113887721-113887743 GAGGCTGGGAAAGATAGTGGGGG - Intergenic
1196552915 X:117051393-117051415 GTGGCTGGGAAGGATAGTGAGGG + Intergenic
1196588818 X:117461628-117461650 GAGGCTGAGAAGGGTGGTGTGGG - Intergenic
1196626611 X:117884445-117884467 GAGGCTAGGAAGCACAGTGGAGG + Intergenic
1196882896 X:120215141-120215163 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1197019433 X:121668855-121668877 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1197354859 X:125425895-125425917 GAGGCTGGGAAGGATGGTGGGGG + Intergenic
1197441099 X:126492463-126492485 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
1197621648 X:128757260-128757282 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
1197749226 X:129953312-129953334 GAGGCCCGGAAGGATGCTTCGGG - Intergenic
1197814937 X:130488173-130488195 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1197841782 X:130755873-130755895 GAGGCTGGGAAGGGTAGTGGTGG - Intronic
1197897727 X:131333285-131333307 GAGGCTGAGAAGGGTAGTGCGGG - Intronic
1197970898 X:132113938-132113960 GAGGCTAGGAAGAGTAGTGGGGG - Intronic
1198366336 X:135943749-135943771 GAGGCTGGGAAGGTTAGTGAGGG + Intergenic
1198538336 X:137608995-137609017 GAGGCTGGGAAGGTTAGTGGGGG + Intergenic
1198871947 X:141185349-141185371 GAGGCTGGGAAGGGTAGTGGGGG - Intergenic
1199140993 X:144312076-144312098 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1199259160 X:145750622-145750644 GAGGCTGGGAAGGTTAGTGGCGG + Intergenic
1199367862 X:147008187-147008209 GAGGCTAGGAAGGATAATGGGGG - Intergenic
1199714429 X:150496205-150496227 GAGGCTGGGAAGGCAGGTGGGGG + Intronic
1199795744 X:151194127-151194149 GAGGCTGGGAAGGGTAGTGGTGG + Intergenic
1199795931 X:151196777-151196799 GAGTCTGGGAAGGATAGTGGGGG - Intergenic
1200379993 X:155826092-155826114 GAGGCTGGGAAGGGTAGTGGAGG + Intergenic
1200510313 Y:4069457-4069479 GAGGCTGGGAAGGGTAGTGGGGG + Intergenic
1200684643 Y:6247436-6247458 GAGGCCAGGAAGACTGGGGCTGG + Intronic
1200992834 Y:9359016-9359038 GAGGCCAGGAAGACTGGGGCTGG + Intronic
1200998153 Y:9399640-9399662 GAGGCCAGGAAGACTGGGGCTGG + Intronic