ID: 1083200564

View in Genome Browser
Species Human (GRCh38)
Location 11:61118756-61118778
Sequence CTCTAAGCCTCCTGCGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 869
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 837}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083200564_1083200570 3 Left 1083200564 11:61118756-61118778 CCCGCCTCGCAGGAGGCTTAGAG 0: 1
1: 0
2: 2
3: 29
4: 837
Right 1083200570 11:61118782-61118804 ACGTGTGGGTCAAGTGGACCTGG 0: 1
1: 0
2: 0
3: 6
4: 61
1083200564_1083200569 -3 Left 1083200564 11:61118756-61118778 CCCGCCTCGCAGGAGGCTTAGAG 0: 1
1: 0
2: 2
3: 29
4: 837
Right 1083200569 11:61118776-61118798 GAGACAACGTGTGGGTCAAGTGG 0: 1
1: 0
2: 0
3: 4
4: 84
1083200564_1083200571 15 Left 1083200564 11:61118756-61118778 CCCGCCTCGCAGGAGGCTTAGAG 0: 1
1: 0
2: 2
3: 29
4: 837
Right 1083200571 11:61118794-61118816 AGTGGACCTGGTGTGCCAAGCGG 0: 1
1: 0
2: 0
3: 20
4: 138
1083200564_1083200573 28 Left 1083200564 11:61118756-61118778 CCCGCCTCGCAGGAGGCTTAGAG 0: 1
1: 0
2: 2
3: 29
4: 837
Right 1083200573 11:61118807-61118829 TGCCAAGCGGCACTCATGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083200564 Original CRISPR CTCTAAGCCTCCTGCGAGGC GGG (reversed) Intronic
900254462 1:1690622-1690644 GCCTCAGCCTCCTGCGTGGCTGG - Intronic
900263213 1:1743897-1743919 GCCTCAGCCTCCTGCGTGGCTGG - Intronic
901150684 1:7099163-7099185 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
901265763 1:7909427-7909449 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
901274153 1:7977872-7977894 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
901361659 1:8706202-8706224 GTCTCAGCCTCCTGAGCGGCTGG - Intronic
901674291 1:10873914-10873936 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
902307856 1:15556349-15556371 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
903167924 1:21534097-21534119 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
903288858 1:22294758-22294780 CCCTCAGCCTCCTGAGAAGCTGG + Intergenic
903358816 1:22764345-22764367 GTCACAGCCACCTGCGAGGCAGG + Intronic
903901952 1:26653376-26653398 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
903947595 1:26973461-26973483 GTCTCAGCCTCCTGAGAAGCTGG - Intergenic
904148911 1:28420137-28420159 CTCCCAGCCTCCTGAGTGGCTGG - Intronic
904627879 1:31817878-31817900 CTCTCAGCCTCCTGAGTCGCTGG + Intergenic
904646077 1:31967420-31967442 GTCTAAGCCTCCTGAGTAGCTGG - Intergenic
905555107 1:38876388-38876410 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
905762829 1:40574608-40574630 ATCTCAGCCTCCTGAGAAGCTGG + Intergenic
907083805 1:51649989-51650011 CTCTCAGCCTCCTGAGAGCTGGG + Intronic
907173834 1:52499282-52499304 GTCTAAGCCTCCTGAGTAGCTGG - Intronic
907389309 1:54146959-54146981 GTCTCAGCCTCCTGAGAAGCTGG - Intronic
907472806 1:54685394-54685416 CTCTAACACTCCTGTGGGGCTGG + Intronic
908166593 1:61464908-61464930 CTCTAAGCCTTCCGCGGGGAAGG - Intergenic
908220364 1:62000001-62000023 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
908721624 1:67132171-67132193 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
909586748 1:77298707-77298729 CTCTTAGCCTCCTGAGTAGCTGG - Intronic
909898676 1:81106887-81106909 ATCTAAGCCTCCTGAGTAGCTGG + Intergenic
909985582 1:82157133-82157155 CTCTCAGCCTCCTGGGTAGCTGG - Intergenic
910253963 1:85228615-85228637 ATCTCAGCCTCCTGCGTAGCTGG + Intergenic
910526030 1:88179443-88179465 ATCTCAGCCTCCTGAGTGGCTGG - Intergenic
910679823 1:89851622-89851644 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
910895831 1:92068328-92068350 ATCTCAGCCTCCTGCGTAGCTGG - Intergenic
911174948 1:94809469-94809491 CTCTCAGCCTCCCACAAGGCTGG + Intergenic
911639165 1:100268508-100268530 ACCTCAGCCTCCTGCGTGGCTGG + Intronic
912767241 1:112425354-112425376 ATCTCAGCCTCCTGAGTGGCTGG - Intronic
912889177 1:113509940-113509962 CTCTGAGGCTTCTGGGAGGCTGG - Intronic
913134742 1:115877520-115877542 CTCAAAGAATCCTGTGAGGCAGG + Intergenic
913437257 1:118859949-118859971 ATCTAAGCCAACTGTGAGGCAGG + Intergenic
914736631 1:150423905-150423927 GCCTCAGCCTCCTGAGAGGCTGG + Intronic
915293528 1:154902843-154902865 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
915408359 1:155680060-155680082 ATCTAAGCCTCCTGAGTAGCTGG - Intronic
915421376 1:155784984-155785006 GTCTAAGCCTCCTGAGTAGCTGG - Intronic
915455511 1:156038019-156038041 CTCTGAGCCTCCTGAGTAGCTGG + Intronic
915614819 1:157029384-157029406 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
915962794 1:160281194-160281216 ATCTCAGCCTCCTGAGTGGCTGG - Intronic
916266049 1:162890841-162890863 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
917324637 1:173819474-173819496 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
917358999 1:174156261-174156283 GTCTCAGCCTCCTGAGAAGCTGG - Intergenic
917529182 1:175818568-175818590 ATCTCAGCCTCCTGAGAAGCTGG - Intergenic
917943476 1:179946369-179946391 ATCTAAGCCTCCTGAGTAGCTGG - Intergenic
918072705 1:181144924-181144946 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
918080646 1:181205414-181205436 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
918305992 1:183246655-183246677 CTCTCAGCCTCTTGGGAGGCTGG + Intergenic
918371086 1:183862245-183862267 ACCTCAGCCTCCTGAGAGGCTGG - Intronic
918457267 1:184734352-184734374 ATCTAAGCCTCCTGAGTAGCTGG - Intronic
918544882 1:185671365-185671387 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
918642812 1:186863873-186863895 GTCTCAGCCTCCTGAGAAGCTGG + Intronic
919908762 1:202097087-202097109 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
920862161 1:209718903-209718925 GTCTCAGCCTCCTGAGAAGCTGG - Intronic
921203663 1:212829848-212829870 GTCTCAGCCTCCTGAGAAGCTGG - Intergenic
921229809 1:213057878-213057900 CTCTCAGCCTCCTGAGTGGCTGG + Intronic
922075970 1:222244811-222244833 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
922110709 1:222552301-222552323 GCCTAAGCCTCCTGAGTGGCTGG - Intergenic
922419388 1:225449366-225449388 CTCTATGCCACCTCCTAGGCTGG + Intergenic
922524759 1:226292273-226292295 GTCTCAGCCTCCTGAGAAGCTGG + Intronic
922638355 1:227200314-227200336 GTCTTAGCCTCCTGAGTGGCTGG - Intronic
922860895 1:228815453-228815475 GCCTCAGCCTCCTGAGAGGCTGG + Intergenic
924465192 1:244293240-244293262 ATCTCAGCCTCCTGAGAGGCTGG + Intergenic
924545656 1:245024660-245024682 GTCTCAGCCTCCTGAGAAGCTGG + Intronic
924610133 1:245566810-245566832 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1063130168 10:3171553-3171575 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
1063158821 10:3404356-3404378 ACCTCAGCCTCCTGAGAGGCTGG + Intergenic
1063376159 10:5555765-5555787 CTCTCAGCCTCCTGAGTAGCCGG + Intergenic
1063799382 10:9555743-9555765 CCCTCAGCCTCCTGAGTGGCTGG + Intergenic
1063924215 10:10961629-10961651 GTCTCAGCCTCCTGCGTAGCTGG - Intergenic
1064115078 10:12570835-12570857 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1064329021 10:14376562-14376584 CTCTCAGCCTCCTGAGTAGCAGG - Intronic
1064644846 10:17450553-17450575 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1064888387 10:20138796-20138818 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1065987371 10:30968556-30968578 GTCTCAGCCTCCTGAGAAGCTGG + Intronic
1066134625 10:32432647-32432669 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
1066341000 10:34533691-34533713 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1066344653 10:34572522-34572544 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1066345988 10:34587235-34587257 GTCTCAGCCTCCTGTGTGGCTGG + Intronic
1067390719 10:45860648-45860670 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1067401045 10:45973756-45973778 CTCTAAGCCTCCTAAGTAGCTGG + Intronic
1067869400 10:49943328-49943350 CTCTAAGCCTCCTAAGTAGCTGG + Intronic
1067872560 10:49975455-49975477 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1068526816 10:58139752-58139774 GTCTCAGCCTCCTGAGAAGCTGG + Intergenic
1069016550 10:63435782-63435804 ATCTCAGCCTCCTGCGTAGCTGG - Intronic
1069387267 10:67895305-67895327 GTCTCAGCCTCCTGCGTAGCTGG - Intronic
1069476775 10:68741026-68741048 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1069543380 10:69312349-69312371 GTCTAAGCCTCCTGAGTAGCTGG + Intronic
1069709674 10:70480313-70480335 CTCTGAACCTCCTACAAGGCTGG - Intronic
1069871034 10:71533157-71533179 CTCCAAGCCGCCTTCGGGGCAGG - Intronic
1069977678 10:72227919-72227941 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1070137906 10:73710867-73710889 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1070159290 10:73856020-73856042 GTCTCAGCCTCCTGAGAGGCTGG + Intronic
1070198637 10:74182481-74182503 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1071537902 10:86451505-86451527 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1071865494 10:89725689-89725711 ATCTCAGCCACCTGGGAGGCTGG - Intronic
1072183268 10:93009097-93009119 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1072198803 10:93140439-93140461 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1072335923 10:94398307-94398329 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1072974228 10:100043756-100043778 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1073156182 10:101348775-101348797 GCCTCAGCCTCCTGCGTGGCTGG - Intergenic
1075807828 10:125202725-125202747 ATCTCAGCCTCCTGAGTGGCTGG - Intergenic
1076643181 10:131932550-131932572 GTCTCAGCCTCCTGCGTCGCCGG - Intronic
1076724914 10:132408788-132408810 CTCTCAGCTTGCTGCGGGGCTGG + Intronic
1077245771 11:1537175-1537197 CTCTCAGCCTCCTGAGTCGCTGG - Intergenic
1077622392 11:3738662-3738684 GTCTCAGCCTCCTGCGTAGCTGG - Intronic
1077699609 11:4429438-4429460 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1078293057 11:10035077-10035099 GCCTCAGCCTCCTGAGAGGCTGG + Intronic
1078809562 11:14744666-14744688 TTCTAAGCATCCTGAAAGGCTGG + Intronic
1079173092 11:18114910-18114932 CCCTCAGCCTCCCGAGAGGCTGG + Intronic
1079922215 11:26447090-26447112 ATCTCAGCCTCCTGCGTAGCTGG - Intronic
1080545213 11:33310420-33310442 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1081714842 11:45242452-45242474 CTCTCAGCCTCCTGGGTAGCTGG - Exonic
1081868142 11:46370968-46370990 GTCTCAGCCTCCTGAGTGGCCGG - Intronic
1082756072 11:57078003-57078025 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1083064812 11:59913772-59913794 ATCTCAGCCTCCTGAGTGGCTGG + Intergenic
1083156439 11:60826250-60826272 GCCTAAGCCTCCTGAGTGGCTGG + Intergenic
1083200564 11:61118756-61118778 CTCTAAGCCTCCTGCGAGGCGGG - Intronic
1083248888 11:61452134-61452156 GTCTCAGCCTCCTGAGAAGCTGG + Intronic
1083413473 11:62509801-62509823 GTCTTAGCCTCCTGAGTGGCTGG - Intronic
1084097441 11:66920921-66920943 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1084109694 11:67005905-67005927 GTCTCAGCCTCCTGCGTAGCTGG - Intergenic
1084126798 11:67104399-67104421 GTCTCAGCCTCCTGAGTGGCTGG - Intergenic
1084542238 11:69794264-69794286 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1084614669 11:70227503-70227525 GCCTCAGCCTCCTGAGAGGCTGG - Intergenic
1085362039 11:75897981-75898003 CTCTCAGCCTCCCGAGTGGCTGG + Intronic
1086574876 11:88328743-88328765 GTCTCAGCCACCTGGGAGGCTGG - Intronic
1087170463 11:95044720-95044742 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1087936094 11:104036327-104036349 CTCTCAGCCTCCTGAAAAGCTGG - Intronic
1088617319 11:111643694-111643716 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1088988536 11:114930312-114930334 CTCTTAGCCCCCAGTGAGGCAGG + Intergenic
1089354681 11:117841922-117841944 CCCTACCCCTCCTGCCAGGCAGG + Intronic
1089450168 11:118588901-118588923 GTCTCAGCCTCCTGCGTAGCTGG - Intronic
1090013836 11:123067485-123067507 CCCTCAGCCTCCTGAGAAGCTGG - Intergenic
1090362336 11:126182257-126182279 CTCCAGGCCTCCCGAGAGGCTGG + Intergenic
1090409925 11:126501098-126501120 CTGTGAGCCTTGTGCGAGGCAGG + Intronic
1090629538 11:128633911-128633933 CTCAAAGCTTCTTGCCAGGCTGG + Intergenic
1091990798 12:4954276-4954298 ATATCAGCCTCCTGCAAGGCAGG + Intergenic
1092275415 12:7057254-7057276 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1092355794 12:7794186-7794208 GTCTCAGCCTCCTGAGAAGCTGG + Intronic
1092457543 12:8657685-8657707 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
1092608510 12:10146854-10146876 CTCTCAGCCTCCTGCGAAGCTGG - Intergenic
1092814405 12:12300541-12300563 CTCTCAGCCTCCCGAGAAGCTGG + Intergenic
1094098441 12:26735113-26735135 GTCTCAGCCTCCTGAGAAGCTGG + Intronic
1095616818 12:44200001-44200023 CTCTCAGCCTCCTGTGTAGCTGG - Intronic
1095672634 12:44877571-44877593 GTCTGAGCCCCCTGCAAGGCAGG + Intronic
1096274262 12:50192018-50192040 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1096278594 12:50232172-50232194 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
1096285545 12:50296627-50296649 GTCTCAGCCTCCTGCGTAGCTGG + Intergenic
1096320134 12:50604570-50604592 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
1096479504 12:51929053-51929075 GTCTCAGCCTCCTGAGAAGCTGG - Intergenic
1096719039 12:53507533-53507555 CCCTAAGGCTACTGTGAGGCTGG - Exonic
1096838696 12:54368298-54368320 CTCTATCCCTACTGAGAGGCAGG - Intergenic
1097001437 12:55880336-55880358 CCCTCAGCCTCCTGAGTGGCTGG - Intergenic
1097334030 12:58362369-58362391 CCCTCAGCCTCCTGAGTGGCTGG + Intergenic
1097891998 12:64786444-64786466 GTCTAAGCCTCCTGAGTAGCTGG + Intronic
1098633185 12:72749557-72749579 GTCTAAGCCTCCTGAGTAGCTGG - Intergenic
1098898848 12:76092009-76092031 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1098928310 12:76378882-76378904 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
1099372416 12:81852495-81852517 CTCTCAGCCTCCTGAGTTGCTGG - Intergenic
1100181403 12:92090480-92090502 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1100497617 12:95140500-95140522 GTCTCAGCCTCCTGCGTAGCTGG - Intronic
1100534395 12:95493224-95493246 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1100541057 12:95557748-95557770 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1101137763 12:101763105-101763127 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1101308124 12:103551700-103551722 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1101470699 12:104994228-104994250 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1101475241 12:105040012-105040034 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1101880890 12:108624802-108624824 GTCTCAGCCTCCTGAGAAGCTGG + Intronic
1102097952 12:110255400-110255422 CTCTTAGCCTCCTGAGTGGCTGG + Intergenic
1102282257 12:111627558-111627580 GTCTCAGCCTCCTGAGTGGCTGG - Intergenic
1102344477 12:112150664-112150686 CTCTTAGCCTCCTGAGTAGCTGG + Intronic
1102399318 12:112614897-112614919 CTCTCAGCCTCCTGAGTTGCTGG + Intronic
1102476697 12:113193240-113193262 CCCTCAGCCTCCTGAGTGGCGGG + Intergenic
1102596534 12:113997012-113997034 GCCTCAGCCTCCTGCGAAGCTGG - Intergenic
1103094546 12:118122407-118122429 GCCTCAGCCTCCTGAGAGGCTGG + Intronic
1103906383 12:124329625-124329647 CTCTCAGCCTCCTGAGCAGCTGG - Intronic
1104908530 12:132228382-132228404 CTCTTTGCCTCTGGCGAGGCAGG + Intronic
1105399995 13:20083175-20083197 CCCTCAGCCTCCTGAGTGGCTGG + Intronic
1105564085 13:21526050-21526072 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1106081336 13:26502517-26502539 GTCTAAGCCTCCTGAGTAGCTGG - Intergenic
1106093324 13:26619373-26619395 CTGTAAGTCTCCTTGGAGGCTGG + Intronic
1106146845 13:27056758-27056780 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1106507994 13:30388182-30388204 GTCTCAGCCTCCTGAGTGGCTGG - Intergenic
1106530345 13:30585031-30585053 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1107845788 13:44511166-44511188 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1108596317 13:51952940-51952962 CTATAAACCTCCTGAGAGGAAGG - Intronic
1108606709 13:52046360-52046382 CTCTCAGCCTCCTGAGTGGCTGG - Intronic
1108942472 13:55974068-55974090 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1109552944 13:63929604-63929626 CTCTCAGCCTCCTGAGTGGTTGG + Intergenic
1109774179 13:67018502-67018524 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1110244746 13:73310066-73310088 GTCTCAGCCTCCTGAGAAGCTGG - Intergenic
1110370620 13:74735964-74735986 CCCTAAGCCTCCTCAGAGGAAGG + Intergenic
1110573776 13:77033771-77033793 GTCTCAGCCTCCTGAGTGGCTGG - Intergenic
1111245974 13:85541665-85541687 CTGTGAGCTTCCTGCTAGGCAGG - Intergenic
1111893225 13:94108725-94108747 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1112021305 13:95373557-95373579 GTCTCAGCCTCCTGCGTAGCTGG - Intergenic
1112139068 13:96618211-96618233 CTCACAGCCTCCTGAGTGGCTGG + Intronic
1112621902 13:101061899-101061921 CTTTCATCCTCCTGCGGGGCAGG + Intronic
1113758053 13:112827795-112827817 CTCTCTGCCTCCTGTGAGGAAGG + Intronic
1113856347 13:113448349-113448371 GCCTCAGCCTCCTGAGAGGCTGG - Intronic
1113925930 13:113941683-113941705 CTGAAGGCCACCTGCGAGGCTGG - Intergenic
1114207547 14:20587036-20587058 CTCTCAGCCTCCCGAGTGGCTGG - Intronic
1114253299 14:20980154-20980176 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1115085355 14:29508534-29508556 GTCTCAGCCTCCTGAGTGGCTGG - Intergenic
1115568761 14:34647800-34647822 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1115585560 14:34808381-34808403 CCCTAAGCCTCCTGAGTAGCTGG - Intronic
1116295854 14:43107705-43107727 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1117108027 14:52418803-52418825 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
1117716326 14:58585394-58585416 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1118150955 14:63189884-63189906 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1118426962 14:65675880-65675902 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1118829237 14:69414160-69414182 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1119768333 14:77204952-77204974 CTCTGAGCATCTTGGGAGGCAGG - Intronic
1119795802 14:77395965-77395987 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1119917734 14:78417869-78417891 CTCTTAGCCTCCTGAGTAGCTGG + Intronic
1120140218 14:80921846-80921868 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1120756632 14:88250774-88250796 GTCTCAGCCTCCTGAGAAGCTGG - Intronic
1120815985 14:88858706-88858728 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1120893977 14:89513337-89513359 CTCTCAGCCTCCTGAGCAGCTGG + Intronic
1121027466 14:90627094-90627116 GTCTCAGCCTCCTGAGTGGCAGG + Intronic
1121030384 14:90653682-90653704 CTCTCAGTCTCATGCCAGGCTGG - Intronic
1121236429 14:92394488-92394510 CTCAAACTCTCCTGCGTGGCTGG - Intronic
1121385325 14:93516559-93516581 GCCTCAGCCTCCTGAGAGGCTGG + Intronic
1121506712 14:94483292-94483314 GTCTCAGCCTCCCGGGAGGCTGG + Intergenic
1122119946 14:99547070-99547092 ATCTCAGCCTCCTGAGTGGCTGG - Intronic
1122190603 14:100039891-100039913 ACCTCAGCCTCCTGAGAGGCTGG + Intronic
1122303947 14:100749627-100749649 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1122334842 14:100965633-100965655 CCCTCAGCCTCCTGCGTAGCTGG - Intergenic
1123112341 14:105878997-105879019 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
1123712879 15:23002963-23002985 CTCTCAGCCTCCTGAATGGCTGG + Intronic
1123848144 15:24325586-24325608 CCCTCAGCCTCCTGAGTGGCTGG + Intergenic
1124047334 15:26162348-26162370 CCCTAAGCCTCCTGAGTAGCTGG - Intergenic
1124322557 15:28726007-28726029 GCCTAAGCCTCCTGAGTGGCTGG + Intronic
1124523488 15:30426728-30426750 GCCTAAGCCTCCTGAGTGGCTGG + Intergenic
1124535179 15:30539486-30539508 GCCTAAGCCTCCTGAGTGGCTGG - Intergenic
1124763476 15:32468111-32468133 GCCTAAGCCTCCTGAGTGGCTGG + Intergenic
1124775152 15:32580937-32580959 GCCTAAGCCTCCTGAGTGGCTGG - Intergenic
1124882365 15:33654398-33654420 CTCTTAGCCTCCTGAGCAGCTGG - Intronic
1125846441 15:42859219-42859241 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1126146584 15:45479150-45479172 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1126639042 15:50806335-50806357 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1126749356 15:51860819-51860841 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1126752148 15:51887102-51887124 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1126769093 15:52037180-52037202 CACTAAGCCTCCTGAGTAGCTGG - Intronic
1127302482 15:57669003-57669025 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1127469298 15:59276135-59276157 CTCTACCCCTGCTGAGAGGCAGG + Intronic
1127745785 15:61970677-61970699 ATCTCAGCCTCTTGGGAGGCTGG + Intronic
1127884612 15:63188806-63188828 CTGCAAGCATCCTGTGAGGCGGG - Intergenic
1127991889 15:64125348-64125370 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1128192810 15:65719778-65719800 ATCTCAGCCTCCTGAGAAGCTGG - Intronic
1128950163 15:71871258-71871280 ATCTTAGCCTCCTGAGTGGCTGG - Intronic
1128977528 15:72164518-72164540 ATCTCAGCCTCCTGCGTAGCTGG + Intronic
1129327045 15:74805911-74805933 CTCTGTGCCTTCTGGGAGGCGGG - Intergenic
1129518330 15:76170540-76170562 CTCTAACTCTCCAGCGGGGCAGG - Intronic
1129537220 15:76323542-76323564 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1130080630 15:80730002-80730024 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1130088570 15:80799963-80799985 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1130586232 15:85185378-85185400 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1131206383 15:90451942-90451964 CTCTCAGCCTCCTGAGGAGCTGG + Intronic
1131471922 15:92704933-92704955 CTCTAAGCCTCCTGCCCTGGAGG + Intronic
1132020234 15:98354597-98354619 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1132797104 16:1730144-1730166 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1133047459 16:3096812-3096834 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1133941038 16:10309264-10309286 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1134147956 16:11782728-11782750 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
1134436173 16:14259632-14259654 CTCTCAGCCTCCTGGGTGGCTGG - Intronic
1134504808 16:14796305-14796327 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1134575765 16:15332604-15332626 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1134621826 16:15695066-15695088 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1135242262 16:20818583-20818605 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1135257559 16:20953271-20953293 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
1135523924 16:23198937-23198959 CACTCAGCCTCCTGCAAAGCTGG - Intronic
1135535694 16:23292616-23292638 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1135826751 16:25735501-25735523 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1136122618 16:28148926-28148948 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1136350557 16:29704248-29704270 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1136370493 16:29833112-29833134 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1136416460 16:30107219-30107241 ATCTCAGCCTCCTGAGTGGCTGG + Intronic
1136484662 16:30563703-30563725 GTCTCAGCCTCCTGGGTGGCTGG - Intergenic
1136493639 16:30627508-30627530 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1136602113 16:31299421-31299443 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1137238017 16:46631472-46631494 GTCTCAGCCTCCTGAGAAGCTGG - Intergenic
1138200926 16:55087781-55087803 ATCAAAGCCTCCAGCGAGGCTGG - Intergenic
1138455305 16:57117439-57117461 CCCCCAGCCTCCTGCCAGGCAGG - Intronic
1138521400 16:57573317-57573339 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1138564883 16:57825792-57825814 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1138816125 16:60204869-60204891 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1139501257 16:67367940-67367962 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1139605780 16:68017284-68017306 GTCTCAGCCTCCTGAGAAGCTGG + Intronic
1140073540 16:71674880-71674902 CTCTTAGCCTCCTGAGTAGCTGG - Intronic
1140492014 16:75345340-75345362 GTCTTAGCCTCCTGAGTGGCTGG - Intronic
1140826394 16:78710727-78710749 ATCTTAGCCTCCTGAGTGGCTGG + Intronic
1141090193 16:81124823-81124845 ATCTCAGCCTCCTGAGAAGCTGG - Intergenic
1141309156 16:82896406-82896428 CTCTCATCCTCCTGAGAAGCTGG + Intronic
1141334531 16:83142273-83142295 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
1141361939 16:83403506-83403528 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1141458807 16:84163917-84163939 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1141656013 16:85416967-85416989 ATCTCAGCCTCCTGGGTGGCTGG + Intergenic
1141700370 16:85639480-85639502 CTCTAAGCCTCCTGGGCGCCAGG + Intronic
1141843747 16:86592765-86592787 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1142538882 17:641567-641589 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1142637017 17:1264109-1264131 CTCTCAGCCTCCTGGGCAGCAGG + Intergenic
1143085790 17:4415160-4415182 GTCTCAGCCTCCTGAGAAGCTGG + Intergenic
1143710381 17:8730452-8730474 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
1143713487 17:8750272-8750294 GTCTCAGCCTCCTGAGAAGCTGG - Intergenic
1143871256 17:9958699-9958721 CTCGAAGCGCCCTGGGAGGCAGG + Intronic
1144499506 17:15772936-15772958 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
1144567750 17:16374002-16374024 GTCTCAGCCTCCTGAGTGGCTGG - Intergenic
1144781435 17:17810289-17810311 CGCTCAGCCTCCGGCGAGGGTGG + Exonic
1144994268 17:19256334-19256356 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1145113685 17:20188371-20188393 GTCTAAGCCTCCGGAGTGGCTGG + Intronic
1145162887 17:20587954-20587976 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
1145180911 17:20751099-20751121 ATCTAAGCCTCCTGAGTAGCTGG - Intergenic
1145931867 17:28691733-28691755 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1146029755 17:29355554-29355576 ATCTCAGCCTCCTGAGTGGCTGG + Intergenic
1146146833 17:30426315-30426337 CTCCAATTCTCCTGCGTGGCTGG - Intronic
1146418635 17:32661538-32661560 ACCTAAGCCTCCTGAGAAGCTGG - Intronic
1146948348 17:36889175-36889197 CTGCAGGCCTCCTGAGAGGCTGG + Intergenic
1147475616 17:40709087-40709109 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
1147612327 17:41809304-41809326 CTCTTAGCCTCCTGAGTAGCTGG - Intronic
1147943897 17:44069429-44069451 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1147954677 17:44125776-44125798 GTCTCAGCCTCCTGAGAAGCTGG - Intergenic
1148071052 17:44908744-44908766 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1148176582 17:45570868-45570890 GTCTCAGCCTCCTGAGTGGCTGG - Intergenic
1148229571 17:45923264-45923286 CTCAAAGGCTCCTGGAAGGCAGG - Intronic
1148294793 17:46492076-46492098 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
1148592068 17:48823912-48823934 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1148770356 17:50062769-50062791 CTCTGGGCCTCCTGCCAGTCTGG - Intronic
1149214057 17:54333768-54333790 GTCTCAGCCTCCTGAGAAGCTGG + Intergenic
1149762131 17:59241811-59241833 GTCTCAGCCTCCTGCGTAGCTGG - Intronic
1149840455 17:59959793-59959815 GTCTAAGCCTCCTGAGTAGCTGG - Intronic
1149939681 17:60850471-60850493 GTCTCAGCCTCCTGAGAAGCTGG + Intronic
1150026453 17:61680235-61680257 GTCTCAGCCTCCTGCGTAGCTGG - Intergenic
1150035475 17:61791372-61791394 GTCTAAGCCTCCTGAGTTGCTGG - Intronic
1150172866 17:63018364-63018386 CTCTCAGCCTCCTGAGGAGCTGG - Intronic
1150407810 17:64917851-64917873 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1151216447 17:72580118-72580140 TTCTCAGCCTCCTGAGTGGCTGG - Intergenic
1151299612 17:73213853-73213875 GTCTCAGCCTCCTGAGAAGCTGG - Intronic
1151414268 17:73951479-73951501 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1151521817 17:74635657-74635679 CTGGAAGCCACCTGCGATGCAGG + Intergenic
1151633033 17:75324304-75324326 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1152306994 17:79526916-79526938 CTTGAAGCCTCCAGCGTGGCTGG - Intergenic
1152837774 17:82545694-82545716 ATCTCAGCCTCCTGAGTGGCTGG + Intronic
1153061935 18:1003999-1004021 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1153204406 18:2681468-2681490 ATCTTAGCCTCCTGAGAAGCTGG - Intronic
1153208740 18:2734954-2734976 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1153661014 18:7326374-7326396 GCCTCAGCCTCCTGAGAGGCTGG + Intergenic
1153708571 18:7773693-7773715 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1153893220 18:9537016-9537038 CTCTGAGGCTTCTGGGAGGCTGG + Exonic
1153916736 18:9752337-9752359 GTCTAAGCCTCCTGAGTAGCTGG + Intronic
1154994662 18:21628263-21628285 ATCTAAGCCTCCTGAGTAGCTGG - Intronic
1155004567 18:21716735-21716757 GCCTCAGCCTCCTGCGTGGCTGG - Intronic
1155293540 18:24364896-24364918 CTCTCAGCCTCCTGAGAAGCTGG - Intronic
1155301511 18:24433586-24433608 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1156732092 18:40206737-40206759 GTCTCAGCCTCCTGAGAAGCTGG + Intergenic
1157317214 18:46602318-46602340 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
1157377145 18:47177041-47177063 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1157599490 18:48885402-48885424 CTCTTCTCCTCCTGGGAGGCAGG - Intergenic
1158017742 18:52804696-52804718 CTCTCAGCCTCCTGAGTTGCTGG + Intronic
1158614818 18:58977328-58977350 CTCGAAGCGTCCTGGGAGGCAGG + Intronic
1158636808 18:59166118-59166140 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
1158917557 18:62150814-62150836 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1159055270 18:63457078-63457100 ATCTCAGCCTCCTGAGCGGCTGG + Intergenic
1159611757 18:70533343-70533365 CCCTCAGCCTCCTGAGAGGCTGG - Intergenic
1160259905 18:77282959-77282981 GTCTAAGCCTCCTGAGTAGCTGG + Intergenic
1160327914 18:77967639-77967661 CTCTCAGCCTCCTGAGGAGCTGG - Intergenic
1160506723 18:79431466-79431488 CGCTCAGCCTCCTGTGTGGCTGG + Intronic
1160506732 18:79431498-79431520 CACTCAGCCTCCTGTGTGGCTGG + Intronic
1160531153 18:79565492-79565514 CTCCAAGCTTCCTCGGAGGCTGG - Intergenic
1160953174 19:1677229-1677251 CTCTCAGCAGCCTGTGAGGCAGG + Intergenic
1161079749 19:2304820-2304842 GTCTCAGCCTCCTGAGAAGCTGG + Intronic
1161410566 19:4114813-4114835 CCCTTAGCCTCCTGAGTGGCTGG - Intronic
1161541723 19:4855806-4855828 CTCTCAGCCTCCTGAGAAGCTGG - Intronic
1161833527 19:6628583-6628605 GTCTCAGCCTCCTGAGTGGCTGG - Intergenic
1162011853 19:7821718-7821740 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1162090075 19:8273788-8273810 GTCTCAGCCTCCTGAGAAGCTGG + Intronic
1162092309 19:8288651-8288673 GTCTCAGCCTCCTGAGAAGCTGG + Intronic
1162195767 19:8983350-8983372 CTCTTAGCCTCCTGAGTAGCTGG - Intergenic
1162365564 19:10246958-10246980 ATCTTAGCCTCCTGAGAAGCTGG + Intergenic
1162469213 19:10862317-10862339 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1162494494 19:11015894-11015916 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1162507354 19:11094073-11094095 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1162514497 19:11139773-11139795 CTCTTAGCCTCCTGAGTAGCTGG + Intronic
1162549452 19:11350536-11350558 TTCTCAGCCTCCTGAGTGGCTGG - Intronic
1163116741 19:15193349-15193371 GTCTCAGCCTCCTGCGTAGCTGG + Intronic
1163758034 19:19118560-19118582 GTCTCAGCCTCCCGAGAGGCTGG + Intergenic
1163881152 19:19923631-19923653 CTTTAAGGCACCAGCGAGGCTGG - Intronic
1163937059 19:20456613-20456635 TCCTCAGCCTCCTGAGAGGCTGG + Intergenic
1163947941 19:20557729-20557751 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1164472614 19:28548691-28548713 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
1164554070 19:29236181-29236203 ATCTCAGCCTCCTGAGAAGCTGG + Intergenic
1165021661 19:32929485-32929507 TTCTCAGCCTCCTGAGTGGCTGG - Intronic
1165129245 19:33621927-33621949 AGCGAAGCCTCCGGCGAGGCTGG - Intergenic
1165143545 19:33717344-33717366 GTCTCAGCCTCCTGAGAAGCTGG - Intronic
1165414166 19:35681505-35681527 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1165465566 19:35972745-35972767 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1165505700 19:36227496-36227518 GTCTCAGCCTCCTGAGAAGCTGG + Intronic
1165591226 19:36971947-36971969 CTCTTAGCCTCCTGAGTAGCTGG + Intronic
1165910150 19:39220811-39220833 GTCTCAGCCTCCTGAGAGGCTGG + Intergenic
1166014090 19:39967066-39967088 CCCTGAGCCTCCTGAGTGGCTGG + Intergenic
1166219078 19:41353781-41353803 CTCTGAGCCGCCCGCGGGGCCGG - Exonic
1166323739 19:42036467-42036489 CTCCCAGCCTCCTGAGTGGCTGG + Intronic
1166363583 19:42267346-42267368 GTCTAAGCCTCCTGAGTAGCTGG - Intergenic
1166572688 19:43808218-43808240 GTCTCAGCCTCCGGAGAGGCTGG + Intronic
1166601421 19:44098696-44098718 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
1166670139 19:44704615-44704637 ATCTCAGCCTCCTGAGTGGCTGG - Intronic
1166755360 19:45187367-45187389 CTCCAAGCCTCCAGCGAAGTTGG - Exonic
1166996089 19:46720309-46720331 CTCTGCACCTCCAGCGAGGCTGG + Exonic
1167181586 19:47908009-47908031 ATCTAAGCCTCCTGAGTAGCTGG + Intergenic
1167182902 19:47918760-47918782 ATCTAAGCCTCCTGAGTAGCTGG + Intergenic
1167183572 19:47924110-47924132 ATCTAAGCCTCCTGAGTAGCTGG + Intergenic
1167184870 19:47934512-47934534 ATCTAAGCCTCCTGAGTAGCTGG + Intergenic
1167186192 19:47945253-47945275 ATCTAAGCCTCCTGAGTAGCTGG + Intergenic
1167462604 19:49634047-49634069 GTCTCAGCCTCCTGAGAAGCTGG + Intergenic
1167757907 19:51424560-51424582 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1168085744 19:54044443-54044465 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
925525738 2:4798804-4798826 ACCTAAGCCTCCTGCGTAGCTGG + Intergenic
926039631 2:9662428-9662450 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
926232612 2:11016311-11016333 ACCTCAGCCTCCTGAGAGGCTGG + Intergenic
926286195 2:11490661-11490683 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
927136749 2:20102525-20102547 GTCTTAGCCTCCTGAGTGGCTGG - Intergenic
927799876 2:26088737-26088759 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
927914240 2:26924766-26924788 CTCACAGCCTCTTGTGAGGCAGG + Intronic
928053723 2:28028879-28028901 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
928154830 2:28867208-28867230 ATCTCAGCCTCCTGCGTAGCTGG + Intronic
929080890 2:38121115-38121137 ATCTAAGCCCCCTGGGATGCTGG - Intergenic
929149719 2:38736624-38736646 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
929161635 2:38838211-38838233 ATCTCAGCCTCCTGAGAGGCTGG + Intronic
929684977 2:44025802-44025824 ATCTCAGCCTCCTGAGTGGCTGG + Intergenic
930007675 2:46910923-46910945 ATCTCAGCCTCCTGAGTGGCTGG - Intronic
930066843 2:47334217-47334239 CCCTCAGCCTCCTGAGTGGCTGG + Intergenic
930169669 2:48238241-48238263 CTCTAGGCCTCCTGAGTAGCTGG + Intergenic
930694412 2:54396716-54396738 GCCTCAGCCTCCTGGGAGGCTGG - Intergenic
930776655 2:55179041-55179063 ATCTCAGCCTCCTGAGTGGCTGG + Intronic
930794109 2:55369564-55369586 GTCTCAGCCTCCTGCGTAGCTGG + Intronic
931304380 2:61014261-61014283 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
931414212 2:62065436-62065458 ATCTCAGCCTCCTGAGTGGCTGG + Intronic
931545757 2:63384634-63384656 GCCTTAGCCTCCTGTGAGGCTGG - Intronic
931705524 2:64943541-64943563 CTCTCAGCCTCCTGAGCGGCTGG - Intergenic
931966773 2:67543978-67544000 CTCAAGGCCTCCTGAGTGGCTGG + Intergenic
932011454 2:67981928-67981950 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
932017568 2:68047676-68047698 CTCTCAGCCTCCTGGGTAGCTGG + Intronic
932185894 2:69695025-69695047 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
933145613 2:78848861-78848883 CACTCAGCCTCCTGAGTGGCTGG + Intergenic
933369092 2:81392386-81392408 CTCTCAGCCTACTGCGACTCAGG - Intergenic
934661261 2:96144872-96144894 GTCGAAGCCTCCTGCAAGGAGGG + Exonic
934901907 2:98166220-98166242 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
934958134 2:98641876-98641898 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
935670034 2:105547322-105547344 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
936052006 2:109231091-109231113 ACCTAAGCCTCCTTCCAGGCAGG - Intronic
936708568 2:115104293-115104315 GCCTAAGCCTCCTGAGTGGCTGG + Intronic
937196426 2:120161261-120161283 GTCTCAGCCTCCTGAGAAGCTGG - Intronic
937358424 2:121212685-121212707 TTATAATCGTCCTGCGAGGCAGG + Intergenic
938813991 2:134881113-134881135 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
939330437 2:140752437-140752459 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
939343595 2:140932762-140932784 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
941217156 2:162726532-162726554 CCCTCAGCCTCCTGAGAAGCTGG + Intronic
941360792 2:164548990-164549012 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
941774524 2:169377690-169377712 CCCTCAGCCTCCTGAGTGGCTGG - Intergenic
941933226 2:170963258-170963280 GTCTCAGCCTCCTGCGTAGCTGG - Intronic
942680081 2:178468981-178469003 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
942771066 2:179521299-179521321 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
942904379 2:181163358-181163380 ACCTCAGCCTCCTGAGAGGCTGG - Intergenic
943520383 2:188942546-188942568 CTCTAAGCCTCTTGAAAGGAAGG - Intergenic
943744047 2:191442613-191442635 GTCTCAGCCTCCTGCGTAGCTGG + Intergenic
944415957 2:199480000-199480022 GTCTCAGCCTCCTGAGTGGCTGG - Intergenic
944649080 2:201810955-201810977 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
944784194 2:203051427-203051449 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
944884600 2:204049476-204049498 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
945028024 2:205637852-205637874 TCCTAAGCAGCCTGCGAGGCAGG - Intergenic
945221529 2:207489192-207489214 ATCTCAGCCTCCCGAGAGGCTGG + Intergenic
945282834 2:208052220-208052242 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
945739564 2:213643893-213643915 GTCTCAGCCTCCTGAGAAGCTGG + Intronic
946926705 2:224633717-224633739 GTCTCAGCCTCCTGCGTAGCTGG + Intergenic
947414156 2:229876157-229876179 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
948876148 2:240830235-240830257 GTCTCAGCCTCCTGCGTAGCTGG - Intergenic
948957795 2:241307405-241307427 AGCTAAGCCTCCTGAGAGACTGG + Intronic
1168828442 20:830383-830405 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1168962245 20:1877460-1877482 CTCTAAGGCATCTGGGAGGCTGG + Intergenic
1170993674 20:21330166-21330188 GTCTCAGCCTCCTGAGAAGCTGG - Intronic
1171089341 20:22269340-22269362 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1171446933 20:25211467-25211489 CTCTTAGCATCCTTTGAGGCTGG + Intronic
1172560395 20:35882911-35882933 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1172584149 20:36070821-36070843 CTCTAGGCAGCCTGCTAGGCTGG + Intergenic
1172590687 20:36115775-36115797 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1173483704 20:43424186-43424208 GTCTCAGCCTCCTGAGTGGCTGG - Intergenic
1174551671 20:51366839-51366861 CTCACAGCATCCTGCCAGGCAGG + Intergenic
1174623622 20:51896149-51896171 CTCTCAGCCTCCTGAGTAGCCGG + Intergenic
1174730033 20:52907117-52907139 CTCTCAGCCTCCTGAGCAGCTGG - Intergenic
1175804430 20:61819690-61819712 CTCTAAGCCCCCTGCCAGGCTGG + Intronic
1175929806 20:62488361-62488383 CTCCCAGCTCCCTGCGAGGCTGG - Intergenic
1177164271 21:17582056-17582078 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
1177206083 21:18013747-18013769 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1177436636 21:21063333-21063355 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1177668880 21:24199243-24199265 CTCTCAGCCTCCCACGATGCTGG + Intergenic
1177819284 21:26013200-26013222 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1177849310 21:26327680-26327702 CACTCAGCCTCCTGAGTGGCTGG - Intergenic
1178115051 21:29408279-29408301 CGCTGAGCCTGCTGCGAGCCTGG + Intronic
1178523537 21:33305632-33305654 CTCTAGGCCTGTTGGGAGGCAGG + Intergenic
1178600809 21:33992962-33992984 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
1179070428 21:38065918-38065940 CTCTAAGTCTGCAGAGAGGCTGG - Intronic
1179621764 21:42621009-42621031 CTCTTAGCCTCCTGAGTAGCTGG - Intergenic
1180923069 22:19532266-19532288 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1181285304 22:21747793-21747815 CTCTCAGCCTCCGGAGTGGCTGG - Intergenic
1181347923 22:22233840-22233862 CTCTAAGCTTCATGGGAGGAGGG + Intergenic
1181587772 22:23863165-23863187 CTCTAAGCCTCCTTCCACGGAGG + Intronic
1181754628 22:25014866-25014888 ATCTTAGCCTCCTGAGAGACTGG - Intronic
1182489539 22:30661988-30662010 GTCTAGGCCTCCTGTGAGGTAGG + Intronic
1182489634 22:30662712-30662734 ACCTTAGCCTCCTGCGTGGCTGG - Exonic
1182542569 22:31052344-31052366 CTGTCAGCCTCCTGCGTAGCTGG - Intergenic
1182599419 22:31449123-31449145 GTCTCAGCCTCCTGCGTAGCTGG + Intronic
1183212397 22:36458913-36458935 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1183249942 22:36723317-36723339 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1183407175 22:37636039-37636061 CTCTTAGCCTCCTGAGCAGCTGG + Intronic
1183573834 22:38674386-38674408 ATCTCAGCCTCCTGAGAGACTGG - Intergenic
1183652373 22:39164810-39164832 CCCTCAGCCTCCTGCGTAGCTGG + Intergenic
1183711954 22:39510071-39510093 GTCTCAGCCTCCTGAGAAGCTGG + Intronic
1183809849 22:40246302-40246324 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1183924321 22:41195188-41195210 GTCTCAGCCTCCTGCGTAGCTGG - Intergenic
1184014252 22:41773758-41773780 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1184119502 22:42440956-42440978 CTCGAGGCCTCCTGCGAACCAGG - Intergenic
1184275420 22:43407011-43407033 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1184595786 22:45513419-45513441 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1184796063 22:46733406-46733428 GCCTCAGCCTCCTGAGAGGCTGG + Intronic
1185276169 22:49951010-49951032 GTCTAAGGCCCCTGTGAGGCTGG - Intergenic
949172264 3:1014781-1014803 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
949551429 3:5115357-5115379 CTCTCAGCCTCCTGAGTAGCCGG - Intergenic
949821980 3:8125604-8125626 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
949991055 3:9579514-9579536 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
949994745 3:9607726-9607748 CCCTCAGCCTCCTGAGTGGCTGG + Intergenic
949996831 3:9624253-9624275 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
950051543 3:9994683-9994705 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
950219129 3:11181166-11181188 CTCTCAGCCTCCTGAGTGGCTGG - Intronic
950332196 3:12165099-12165121 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
950613929 3:14144449-14144471 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
950721015 3:14882581-14882603 CTCTTAGCCTCCTGAGTAGCTGG - Intronic
950979378 3:17285638-17285660 ATCTAAGCCTGCTGCCAGTCAGG - Intronic
950990087 3:17425510-17425532 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
951930943 3:27966517-27966539 CTCTGAGCCTCCAGTGAGGTGGG - Intergenic
952018516 3:28988590-28988612 ATCTCAGCCACCTGGGAGGCTGG + Intergenic
952448801 3:33410956-33410978 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
953321915 3:41980172-41980194 GTCTCAGCCTCCTAAGAGGCTGG + Intergenic
954038107 3:47864090-47864112 CTCTCAGCCTCCTGAGAAGCTGG + Intronic
954055396 3:48019225-48019247 GCCTCAGCCTCCTGAGAGGCTGG - Intronic
954088196 3:48263642-48263664 CCCTCAGCCTCCTGCGTAGCTGG - Intronic
954689929 3:52390348-52390370 ATCTCAGCCTCCTGAGAAGCTGG - Intronic
954769828 3:52956644-52956666 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
955317325 3:57949637-57949659 CTCTCAGCCTCCAGAGAAGCTGG - Intergenic
955589732 3:60522223-60522245 GTCTCAGCCTCCTGAGAAGCTGG + Intronic
955947240 3:64207012-64207034 ATCTCAGCCTCCTGAGAAGCTGG + Intronic
956111860 3:65877994-65878016 GCCTAAGCCTCCTGAGAAGCTGG - Intronic
956430024 3:69177222-69177244 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
956437292 3:69246339-69246361 ATCTCAGCCTCCTGAGTGGCTGG - Intronic
956642121 3:71425228-71425250 GTCTCAGCCTCCTGCGTAGCTGG + Intronic
956704630 3:71988781-71988803 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
957313717 3:78551133-78551155 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
957629480 3:82701002-82701024 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
959007359 3:101035417-101035439 GTCTAAGCCTCCTGAGTAGCTGG - Intergenic
959076654 3:101756172-101756194 GTCTAAGCCTCCTGAGTAGCTGG + Intronic
959120848 3:102230318-102230340 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
959326277 3:104940852-104940874 GTCTCAGCCTCCTGAGTGGCTGG - Intergenic
959712807 3:109401714-109401736 GTCTAAGCCTCCTGATAGGTGGG + Intergenic
960150285 3:114242307-114242329 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
960342427 3:116490174-116490196 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
960919555 3:122732587-122732609 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
961268242 3:125665613-125665635 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
962032463 3:131615765-131615787 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
962103160 3:132363820-132363842 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
962253786 3:133856523-133856545 CTCTTAGCCTCTAGAGAGGCTGG + Intronic
962475555 3:135752160-135752182 CTTTCAGCCTCCTGGGAGCCTGG - Intergenic
963313551 3:143734080-143734102 ATCTCAGCCTCCTGAGAAGCTGG - Intronic
964006787 3:151839489-151839511 ATCTCAGCCTGCTGAGAGGCTGG - Intergenic
964128206 3:153258884-153258906 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
965187919 3:165489004-165489026 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
965443039 3:168739702-168739724 GTCTCAGCCTCCTGAGTGGCTGG - Intergenic
965593406 3:170383758-170383780 CACTGAGCCTCCTGTGAGTCAGG + Intronic
966828910 3:183989052-183989074 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
967219998 3:187240744-187240766 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
967484206 3:190011158-190011180 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
967882999 3:194314788-194314810 ACCTCAGCCTCCTGAGAGGCTGG - Intergenic
967982737 3:195075570-195075592 CTCTGCGCCTCCTGGCAGGCTGG - Intronic
968074773 3:195810320-195810342 TTCTTAGCCTGCTGAGAGGCAGG + Intronic
968111148 3:196047887-196047909 GCCTCAGCCTCCTGAGAGGCTGG - Intronic
969210380 4:5682742-5682764 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
969387978 4:6869077-6869099 CTGTAAGCTTCCTGAGGGGCGGG - Intronic
969668626 4:8576707-8576729 CTGTCAGCCTCCTGAGTGGCTGG + Intronic
969860367 4:10031027-10031049 ATCTAAGCCCCCTGAAAGGCAGG - Intronic
970103210 4:12548832-12548854 CACTAAGTCTCCTGTGAAGCTGG - Intergenic
971181573 4:24333125-24333147 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
971811485 4:31433287-31433309 GTCTCAGCCTCCTGAGTGGCTGG - Intergenic
972510913 4:39768328-39768350 CTCAGAGCCTCCTGGGTGGCTGG - Intronic
972603615 4:40593933-40593955 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
973738739 4:53899288-53899310 CTCTAAGCCTCCTCCGCTGAAGG + Intronic
974032263 4:56786736-56786758 TTCTCAGCCTCCTGAGAAGCTGG - Intergenic
974556328 4:63453537-63453559 CACTCAGCCTCCTGAGTGGCTGG + Intergenic
975285786 4:72617835-72617857 GTCTTAGCCTCCTGAGTGGCTGG - Intergenic
975428292 4:74256222-74256244 CTCTTAGCCTCCTGAGTAGCTGG + Intronic
975460764 4:74650969-74650991 CCCTCAGCCTCCTGAGAAGCTGG - Intergenic
975469030 4:74743497-74743519 CACTCAGCCTCCTGAGAAGCTGG - Intergenic
975562046 4:75717323-75717345 ATCTCAGCCTCCTGCGTAGCTGG - Intronic
975679234 4:76859199-76859221 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
975754211 4:77556902-77556924 CTCTCGGCCTCCTGAGTGGCTGG - Intronic
977092837 4:92700875-92700897 CTCTCAGCCTCCCGCGTAGCTGG - Intronic
977355447 4:95940590-95940612 GTCTCAGCCTCCTGAGAAGCAGG + Intergenic
977388157 4:96371508-96371530 CTCAAGGCCTCCTGAGAAGCTGG + Intergenic
978875815 4:113639128-113639150 CCCTCAGCCTCCTGAGAAGCTGG - Intronic
979232911 4:118366783-118366805 GTCTCAGCCTCCTGAGAAGCTGG + Intergenic
980098325 4:128516471-128516493 CTCTAAGCCTCCTGATATCCTGG - Intergenic
980718245 4:136656953-136656975 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
981095999 4:140782375-140782397 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
981922459 4:150100025-150100047 GTCTCAGCCTCCTGAGAAGCTGG + Intronic
982175624 4:152702998-152703020 GCCTCAGCCTCCTGAGAGGCTGG - Intronic
982498642 4:156125627-156125649 GTCTCAGCCTCCTGAGTGGCTGG - Intergenic
982724966 4:158896581-158896603 ATCTAAGCCTCCTAAGAGACTGG + Intronic
983498162 4:168468050-168468072 ATCTCAGCCTCCTGTGTGGCTGG - Intronic
984653291 4:182291548-182291570 CTCACAGCCTCCTGTGAGACTGG + Intronic
985015669 4:185631645-185631667 GCCTCAGCCTCCTGCGTGGCTGG - Intronic
985097299 4:186425958-186425980 GCCTCAGCCTCCTGAGAGGCTGG + Intergenic
985696220 5:1342122-1342144 CTCTCAGCCTCCTGAGATGGAGG - Intronic
985746800 5:1652587-1652609 CTCACAGCATCCTGCGAGGCTGG - Intergenic
985747959 5:1657902-1657924 GTCTCAGCCTCCTGAGAAGCTGG + Intergenic
986687185 5:10285116-10285138 GCCTCAGCCTCCTGAGAGGCTGG + Intronic
986825305 5:11514069-11514091 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
987904736 5:24060852-24060874 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
988178611 5:27760975-27760997 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
988211947 5:28215231-28215253 CTTTAAGCCTCCTGCCAAACTGG + Intergenic
988438301 5:31202520-31202542 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
988829521 5:34973857-34973879 GTCTAAGCCTCCTGAGTAGCTGG + Intergenic
989391819 5:40908499-40908521 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
990220483 5:53582990-53583012 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
990326730 5:54684381-54684403 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
990329382 5:54711031-54711053 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
990436250 5:55795078-55795100 CCCTCAGCCTCCTGAGTGGCTGG + Intronic
990657979 5:57979043-57979065 ATCTCAGCCTCCTGAGTGGCTGG + Intergenic
990802817 5:59624437-59624459 CTTTAAGCTTCCTGAGAGACTGG + Intronic
990821016 5:59840390-59840412 CTGTAAGCCTCATGAGAGGAGGG + Intronic
990915132 5:60895054-60895076 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
991108554 5:62870577-62870599 GTCTCAGCCTCCTGAGTGGCTGG - Intergenic
991341392 5:65614618-65614640 CCCTCAGCCTCCTGAGTGGCTGG - Intronic
991904163 5:71491830-71491852 ATCTCAGCCTCCTGAGAAGCTGG + Intronic
991904946 5:71500438-71500460 CCCTCAGCCTCCTGAGTGGCTGG + Intronic
991932894 5:71772020-71772042 CTCTCAGCCTCCTGAGTAGCAGG + Intergenic
993893255 5:93500752-93500774 CTCAAAGCCTCCTGAGTAGCTGG + Intergenic
994170802 5:96657980-96658002 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
994376791 5:99024329-99024351 ATCTCAGCCTCCTGTGTGGCTGG + Intergenic
994411165 5:99408953-99408975 CCCTCAGCCTCCTGAGTGGCTGG - Intergenic
994482666 5:100356325-100356347 CCCTCAGCCTCCTGTGTGGCTGG + Intergenic
994927333 5:106134040-106134062 CTCTTAGCCTCCTGAGTAGCTGG - Intergenic
995971962 5:117983400-117983422 GTCTAAGCCTCCTGAGTAGCTGG - Intergenic
996412775 5:123176594-123176616 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
996798800 5:127379712-127379734 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
997146750 5:131442900-131442922 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
997244071 5:132331216-132331238 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
997283120 5:132660872-132660894 CTCGGAGCCTCATCCGAGGCAGG + Exonic
997540785 5:134660249-134660271 ATCTAAGCCTCCTGAGAAGCTGG - Intronic
998109640 5:139491259-139491281 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
999145142 5:149387657-149387679 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1001140610 5:169140685-169140707 CCCTCAGCCTCCTGAGAGGTTGG - Intronic
1001486296 5:172121980-172122002 CTCTCAGCCTCCCGAGTGGCTGG + Intronic
1001913509 5:175540656-175540678 CTCCAAGCCTCCTGCCTGGCTGG - Intergenic
1002162730 5:177325514-177325536 ATCTCAGCCTCCTGAGAAGCTGG - Intergenic
1002372145 5:178763412-178763434 GTCTCAGCCTCCTGAGAAGCTGG + Intergenic
1002704617 5:181151868-181151890 CACTCAGCCTCCTGAGTGGCTGG - Intergenic
1004694053 6:18017787-18017809 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
1006032776 6:31189489-31189511 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1006527602 6:34620587-34620609 ACCTTAGCCTCCTGGGAGGCTGG - Intronic
1006538662 6:34721405-34721427 GTCTAAGCCTCCTGAGTAGCTGG + Intergenic
1006572258 6:35015382-35015404 ATCTCAGCCTCCTGAGTGGCTGG - Intronic
1006763323 6:36483000-36483022 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1006858882 6:37156251-37156273 ACCTCAGCCTCCTGAGAGGCTGG + Intergenic
1007456786 6:41984459-41984481 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1007689663 6:43691962-43691984 CTCTCAGCCTCCTGAGGAGCTGG + Intergenic
1007726600 6:43920523-43920545 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1007773716 6:44211730-44211752 GTCTGAGCCTCCTGCGTAGCTGG + Intergenic
1008042733 6:46819001-46819023 ACCTCAGCCTCCTGAGAGGCTGG - Intronic
1008064944 6:47037617-47037639 GTCTCAGCCTCCTGGGTGGCTGG + Intronic
1010174308 6:73009104-73009126 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1010374045 6:75145744-75145766 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
1010557897 6:77307404-77307426 ATCTCAGCCTCCTGAGTGGCTGG + Intergenic
1010967835 6:82233035-82233057 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1011459955 6:87592512-87592534 GCCTCAGCCTCCTGAGAGGCTGG - Intronic
1011466468 6:87662308-87662330 CCCTCAGCCTCCTGAGAGGCTGG - Intronic
1011940839 6:92841191-92841213 GTCTCAGCCTCCTGAGAAGCTGG - Intergenic
1012318240 6:97807809-97807831 GCCTCAGCCTCCTGAGAGGCTGG - Intergenic
1013231233 6:108164083-108164105 CTCGAACGCTCCTGCCAGGCTGG - Intronic
1013528358 6:110996291-110996313 GTCTAAGCCTCCTGAGTAGCTGG + Intronic
1013805965 6:113996306-113996328 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1013885383 6:114958899-114958921 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1014452435 6:121596628-121596650 CTCTCAGCCTCCTGGGTAGCTGG + Intergenic
1015423679 6:133039665-133039687 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1015535758 6:134266096-134266118 CCCTCAGCCTCCTGAGTGGCTGG + Intronic
1015542916 6:134334091-134334113 GCCTCAGCCTCCTGAGAGGCTGG + Intergenic
1015621727 6:135139090-135139112 GTCTCAGCCTCCTGAGAAGCTGG + Intergenic
1015827497 6:137330169-137330191 GCCTCAGCCTCCTGCGTGGCTGG + Intergenic
1016153207 6:140770146-140770168 GTCTAAGCCTCCTGAGTAGCTGG - Intergenic
1016390266 6:143567511-143567533 GTCTGAGCCTCCTGCGTAGCTGG + Intronic
1016713371 6:147198033-147198055 GTCTCAGCCTCCTGAGAAGCTGG - Intergenic
1016896235 6:149056220-149056242 CTCTCAGCCTCCTGAGTGGCTGG + Intronic
1016926541 6:149355550-149355572 GTCTGAGCCTCCTGTGAAGCTGG - Intronic
1016940486 6:149479244-149479266 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1016969880 6:149751594-149751616 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
1017921105 6:158872782-158872804 GTCTCAGCCTCCTGAGAAGCTGG + Intronic
1018022706 6:159776901-159776923 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
1018421926 6:163647549-163647571 CGCTAAACCTCCTGCAATGCAGG + Intergenic
1018846313 6:167559321-167559343 GTCTCAGCCTCCTGAGAAGCTGG + Intergenic
1018976968 6:168573542-168573564 CTCTGCGCCTCCTCCCAGGCTGG - Intronic
1019175308 6:170156586-170156608 CTCTAGGCCTGCTGCGATGGAGG - Intergenic
1019544519 7:1567126-1567148 CTCTGAGCCTGCTGGGAAGCTGG - Intergenic
1019880698 7:3858300-3858322 CTCTTAGCCTCCTGAGTAGCTGG - Intronic
1019968950 7:4524710-4524732 TTCTCAACCTCCTGAGAGGCTGG - Intergenic
1020019209 7:4852561-4852583 ATCTAAGCCTCCTGAGTAGCTGG + Intronic
1020111565 7:5450913-5450935 CTCTCAGCCCCCAGCAAGGCTGG + Intronic
1020138018 7:5597252-5597274 ATCTAAGCCTCCTGAGTAGCTGG - Intronic
1020153505 7:5702258-5702280 CTCCCAGCCTCCTCCAAGGCGGG + Intronic
1020391858 7:7666920-7666942 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1020929879 7:14379672-14379694 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1021240890 7:18199809-18199831 ATCTCAGCCTCCTGCGTGGTAGG - Intronic
1022833583 7:34092569-34092591 CTCTGAGCCTTCTGTCAGGCTGG + Intronic
1022919023 7:34993949-34993971 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1023395561 7:39748696-39748718 ATCTCAGCCTCCTGAGTGGCTGG + Intergenic
1023420088 7:39970117-39970139 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
1024095939 7:45982972-45982994 CTCTCAGCTGCCTGCCAGGCCGG - Intergenic
1024266095 7:47607663-47607685 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
1024763672 7:52630441-52630463 CCCTAATCCTCCTGCCAGGATGG - Intergenic
1024954231 7:54899591-54899613 ATCTCAGCCTCTTGAGAGGCTGG + Intergenic
1025065453 7:55850960-55850982 CTCTTAGCCTCCTGAGTAGCTGG - Intronic
1025174900 7:56794169-56794191 CCCTCAGCCTCCTGAGAAGCTGG - Intergenic
1025187476 7:56872059-56872081 GTCTCAGCCTCCTGAGATGCTGG - Intergenic
1025228102 7:57180906-57180928 CTCTCAGCCTCCTGAGCAGCTGG - Intergenic
1025684448 7:63704861-63704883 GTCTCAGCCTCCTGAGATGCTGG + Intergenic
1025696903 7:63782245-63782267 CCCTCAGCCTCCTGAGAAGCTGG + Intergenic
1025729446 7:64097109-64097131 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1025796700 7:64744662-64744684 CTCTCAGCCTCCTGAGGAGCTGG - Intergenic
1026176942 7:68006319-68006341 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
1026272432 7:68848308-68848330 CCCTCAGCCTCCTGAGTGGCTGG + Intergenic
1026343013 7:69450178-69450200 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1026554158 7:71391595-71391617 GTCTCAGCCCCCTGAGAGGCTGG + Intronic
1026963303 7:74423535-74423557 GTCTCAGCCTCCTGAGTGGCTGG - Intergenic
1027221261 7:76215739-76215761 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
1027253333 7:76413375-76413397 CTCTCAGCTTCCTGCGTAGCTGG + Intronic
1027339726 7:77192806-77192828 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1027748059 7:82103191-82103213 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1028125657 7:87110061-87110083 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
1029180329 7:98696038-98696060 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1029183693 7:98723013-98723035 ACCTCAGCCTCCTGAGAGGCTGG + Intergenic
1029275072 7:99399091-99399113 CTCCCAGCCTCCTGCCAGGCAGG - Intronic
1029366084 7:100117384-100117406 GTCTCAGCCTCCTGCGTAGCTGG + Intronic
1029705256 7:102272677-102272699 CTCTCACCCTCCTGCAGGGCAGG + Intronic
1030006892 7:105128807-105128829 CTCTCAGCCTCCAGAGAAGCTGG + Intronic
1033039194 7:137902929-137902951 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1033210283 7:139455131-139455153 GCCTCAGCCTCCTGAGAGGCTGG + Intronic
1033315825 7:140296636-140296658 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1033357420 7:140611422-140611444 CCCTAAGCCTCCTGCGTAGCTGG - Intronic
1033373906 7:140738729-140738751 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
1033686602 7:143646415-143646437 CTCTCAGCCTCCTGTGTTGCTGG - Intronic
1033689132 7:143720892-143720914 CTCTCAGCCTCCTGTGTTGCTGG + Intronic
1033698008 7:143811200-143811222 CTCTCAGCCTCCTGTGTTGCTGG + Intergenic
1033799771 7:144887074-144887096 CCCTCAGCCTCCTGCGTAGCTGG + Intergenic
1034399913 7:150855429-150855451 CTGTGAGCCTCCTGCAGGGCTGG - Intronic
1034521083 7:151620590-151620612 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
1035467869 7:159091557-159091579 CCCTGGGCCCCCTGCGAGGCAGG - Intronic
1035897632 8:3421932-3421954 CTCTAAGCCATCTGTGGGGCCGG - Intronic
1035897640 8:3421970-3421992 CTCTAAGCCATCTGTGGGGCCGG - Intronic
1035914007 8:3598964-3598986 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1036193738 8:6695548-6695570 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1036791270 8:11721880-11721902 CTCTACACCTCCTGGGAGGTAGG - Intronic
1036937563 8:13018285-13018307 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1037200130 8:16242027-16242049 GTCTCAGCCTCCTGAGAAGCTGG - Intronic
1038218660 8:25586824-25586846 CTTTAAGCCTCCTGAGTAGCTGG + Intergenic
1038297293 8:26306056-26306078 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1038631875 8:29253227-29253249 ATCTCAGCCTCCTGAGAAGCTGG - Intronic
1039523260 8:38190544-38190566 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1039973467 8:42339659-42339681 ATCTCAGCCTCCTGAGTGGCTGG + Intronic
1040536509 8:48315652-48315674 CTCTCAGTCTCCTGAGTGGCTGG + Intergenic
1041500870 8:58536940-58536962 GTCTCAGCCTCCTGAGAAGCTGG + Intergenic
1042558342 8:70052748-70052770 ATCTCAGCCTCCTGAGAAGCTGG - Intronic
1042937002 8:74069715-74069737 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1043230612 8:77795634-77795656 GTCTCAGCCTCCTGTGTGGCTGG + Intergenic
1043424531 8:80135427-80135449 CTCTAACTCTCCTGGGGGGCAGG - Intronic
1043841573 8:85111260-85111282 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1043974021 8:86564753-86564775 CTCACAGCCTCCTGCGTAGCTGG - Intronic
1044533800 8:93337433-93337455 CTCTCAGCCTCCTGGGTAGCTGG - Intergenic
1044663676 8:94615044-94615066 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
1044891710 8:96843018-96843040 GTCTCAGCCTCCTGAGTGGCTGG + Intronic
1045098510 8:98822911-98822933 CCCTCAGCCTCCTGAGAGGCTGG - Intronic
1045149430 8:99387330-99387352 TTCTAAGCCTCCTGAGTAGCAGG + Intronic
1045162665 8:99566555-99566577 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1045349541 8:101325676-101325698 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
1045575909 8:103419563-103419585 CTCTAAGCTTCCTGTAGGGCAGG - Intronic
1045597018 8:103668793-103668815 ACCTAAGCCTCCTGAGAAGCTGG + Intronic
1046897519 8:119488693-119488715 ATCTCAGCCTCCTGAGTGGCTGG + Intergenic
1047259735 8:123244675-123244697 GCCTAAGCCTCCTGAGAAGCTGG - Intronic
1047273663 8:123388505-123388527 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1047998512 8:130358369-130358391 CTCCAAGCCGCGCGCGAGGCAGG + Intronic
1048341996 8:133547381-133547403 CTCTAAGCCTCCTGAGTAGCTGG + Intronic
1048528960 8:135229993-135230015 CTCTCAGCAACCTGCAAGGCAGG + Intergenic
1048550105 8:135426204-135426226 ATCTCAGCCTCCTGAGTGGCTGG - Intergenic
1049561053 8:143310456-143310478 ATCTCACCCTCCTGCGAGTCAGG - Intronic
1049674173 8:143882518-143882540 CTCCAAGGCACCTGCAAGGCTGG + Intergenic
1049834746 8:144727925-144727947 GTCTCAGCCTCCTGAGAAGCTGG + Intronic
1050727019 9:8662029-8662051 CCCTCAGCCTCCTGAGTGGCTGG + Intronic
1051071507 9:13173586-13173608 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1052751865 9:32499867-32499889 GCCTCAGCCTCCTGAGAGGCTGG + Intronic
1052870544 9:33501923-33501945 CTCTCAGCCTCCTGAGCAGCTGG - Intergenic
1053096730 9:35334921-35334943 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1053399958 9:37810035-37810057 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1055023700 9:71696654-71696676 CCCTCAGCCTCCTGAGAAGCTGG - Intronic
1055071251 9:72168283-72168305 ACCTAAGCCTCCTGCGTAGCTGG - Intronic
1055531721 9:77191408-77191430 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1055966060 9:81866395-81866417 CCCTAAGCCTCCTGAGTAGCTGG + Intergenic
1056653212 9:88486639-88486661 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1056874633 9:90316394-90316416 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
1056990338 9:91404885-91404907 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1057940809 9:99282059-99282081 GTCTAAGCCTCCTGAGTAGCTGG + Intergenic
1057985414 9:99708535-99708557 GTCTCAGCCTCCTGAGAAGCTGG - Intergenic
1058051885 9:100414684-100414706 CTCTCAGCCTCCTGAGTGGCTGG + Intergenic
1058174195 9:101719302-101719324 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1058969298 9:110065341-110065363 ACCTCAGCCTCCTGAGAGGCTGG + Intronic
1059168883 9:112105602-112105624 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1059950966 9:119462167-119462189 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1060586559 9:124790282-124790304 ATCTCAGCCTCCTGAGTGGCTGG + Intronic
1060824549 9:126680418-126680440 CTGTAAGACCCCTGCGAGGTAGG - Intronic
1061031863 9:128089747-128089769 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1061211631 9:129196951-129196973 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
1061238060 9:129353366-129353388 CTCCAGGCCTGCTGCCAGGCCGG + Intergenic
1185742896 X:2548015-2548037 TTCTTAGCCTCCTGAGAAGCTGG - Intergenic
1186147941 X:6644315-6644337 CTCTAAGCCTTCAGGGAGACTGG + Intergenic
1186551560 X:10511128-10511150 GTCTCAGCCTCCTGAGTGGCTGG - Intronic
1186572986 X:10735802-10735824 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1186985395 X:15008479-15008501 GTCTCAGCCTCCTGAGTGGCTGG + Intergenic
1187052073 X:15704749-15704771 ATCTCAGCCTCCTGAGAAGCTGG - Intronic
1187319610 X:18227889-18227911 CACTCAGCCTCCTGGGGGGCGGG + Intergenic
1187330365 X:18333160-18333182 GCCTTAGCCTCCTGAGAGGCTGG - Intronic
1187495777 X:19794285-19794307 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1189237532 X:39499004-39499026 CTCTCAGCCTCCTGGGTAGCTGG - Intergenic
1189438724 X:41015684-41015706 CTCTTAGCCTCCAGAGTGGCTGG - Intergenic
1189829149 X:44952891-44952913 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1190011035 X:46784869-46784891 CTCAAAGCCTCCTGAGTAGCTGG - Intergenic
1190809366 X:53868767-53868789 CTCTCAGCCTCCTGAGTAGCTGG + Intergenic
1190913280 X:54791030-54791052 CTCTGTGCCTGCTGCCAGGCTGG + Exonic
1192569809 X:72193754-72193776 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1192703855 X:73507635-73507657 GCCTCAGCCTCCTGAGAGGCTGG + Intergenic
1192778855 X:74273680-74273702 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1192890611 X:75386588-75386610 CTCTCAGCCTCCTGAGTAGCTGG + Intronic
1193193979 X:78607962-78607984 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic
1195040115 X:101006104-101006126 GCCTCAGCCTCCTGAGAGGCTGG - Intergenic
1196422205 X:115534491-115534513 ATCTCAGCCTCCTGAGTGGCTGG + Intergenic
1196785381 X:119417309-119417331 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1196817938 X:119679741-119679763 CTCTCAGCCTCCTGAGTGGCTGG - Intronic
1196825395 X:119736528-119736550 CACTGAGCCTCCTGAGTGGCTGG - Intergenic
1196833983 X:119798137-119798159 GTCTAAGCCTCCTGAGTAGCTGG - Intergenic
1196984291 X:121251417-121251439 GTCTCAGCCTCCTGAGAAGCTGG + Intergenic
1197129963 X:122993996-122994018 ATCTAAGCCTCCTGAGTAGCTGG - Intergenic
1197203108 X:123765924-123765946 GTCTCAGCCTCCTGAGAAGCTGG + Intergenic
1197263296 X:124338682-124338704 CTCTCAGCCTCCTGAGTAGCTGG - Intronic
1198211674 X:134522055-134522077 ATCTCAGCCTCCTGAGTGGCTGG + Intergenic
1199011364 X:142762669-142762691 CTCTAAGCCTCCTGAGGAGGTGG + Intergenic
1199761968 X:150911859-150911881 GTCTAAGCCTCCTGAGTAGCTGG + Intergenic
1200203264 X:154296899-154296921 CTCTCAGCCTCCCGCGTAGCTGG - Intronic
1200794500 Y:7328483-7328505 CTCTCAGCCTCCTGAGTTGCTGG + Intergenic
1201565419 Y:15360525-15360547 TTCTAAGCCTCTTGAAAGGCAGG + Intergenic
1201905034 Y:19078778-19078800 ATCTCAGCCTCCTGAGTGGCTGG - Intergenic
1201921809 Y:19241648-19241670 CTCTCAGCCTCCTGAGTAGCTGG - Intergenic