ID: 1083201190

View in Genome Browser
Species Human (GRCh38)
Location 11:61122009-61122031
Sequence AGAGTCCCAGAGACCCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 437}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083201188_1083201190 -5 Left 1083201188 11:61121991-61122013 CCCTGGGGAGCTAGACAGAGAGT 0: 1
1: 1
2: 1
3: 15
4: 159
Right 1083201190 11:61122009-61122031 AGAGTCCCAGAGACCCAGAAAGG 0: 1
1: 0
2: 4
3: 48
4: 437
1083201181_1083201190 26 Left 1083201181 11:61121960-61121982 CCCGGTCAGGGTGCATGTCTCTA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1083201190 11:61122009-61122031 AGAGTCCCAGAGACCCAGAAAGG 0: 1
1: 0
2: 4
3: 48
4: 437
1083201189_1083201190 -6 Left 1083201189 11:61121992-61122014 CCTGGGGAGCTAGACAGAGAGTC 0: 1
1: 0
2: 0
3: 12
4: 218
Right 1083201190 11:61122009-61122031 AGAGTCCCAGAGACCCAGAAAGG 0: 1
1: 0
2: 4
3: 48
4: 437
1083201182_1083201190 25 Left 1083201182 11:61121961-61121983 CCGGTCAGGGTGCATGTCTCTAA 0: 1
1: 0
2: 0
3: 5
4: 122
Right 1083201190 11:61122009-61122031 AGAGTCCCAGAGACCCAGAAAGG 0: 1
1: 0
2: 4
3: 48
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083201190 Original CRISPR AGAGTCCCAGAGACCCAGAA AGG Intronic