ID: 1083203361

View in Genome Browser
Species Human (GRCh38)
Location 11:61132984-61133006
Sequence AGCACAGCAGGAGGCCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 312}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083203361_1083203365 -8 Left 1083203361 11:61132984-61133006 CCCTGGGGGCCTCCTGCTGTGCT 0: 1
1: 0
2: 2
3: 57
4: 312
Right 1083203365 11:61132999-61133021 GCTGTGCTGCCCTACCATCCAGG 0: 1
1: 0
2: 1
3: 17
4: 114
1083203361_1083203366 -7 Left 1083203361 11:61132984-61133006 CCCTGGGGGCCTCCTGCTGTGCT 0: 1
1: 0
2: 2
3: 57
4: 312
Right 1083203366 11:61133000-61133022 CTGTGCTGCCCTACCATCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083203361 Original CRISPR AGCACAGCAGGAGGCCCCCA GGG (reversed) Intronic
900198755 1:1392639-1392661 ACCACAGCAGGAGTCGGCCATGG + Intronic
900390944 1:2433560-2433582 CGCACAGCAGGAGCCTCCCCGGG + Intronic
900403152 1:2480924-2480946 AGCAAAGCAGCAAGGCCCCAGGG - Intronic
900551416 1:3258088-3258110 CTCACAGCTGGAGGTCCCCAGGG - Intronic
900701105 1:4049149-4049171 AGCACAGCCAGGGGCTCCCAGGG - Intergenic
900974632 1:6009273-6009295 TGCACAGGTGGATGCCCCCATGG - Intronic
901461247 1:9393062-9393084 GGCACAGCAGGACACCCTCAGGG + Intergenic
902075970 1:13786083-13786105 AGCACTGCAGGAGGCCGAGACGG - Intronic
902512200 1:16972534-16972556 ACCCCAGCTTGAGGCCCCCAAGG - Exonic
902532246 1:17097957-17097979 TGCAGAGCAGGATGCCCGCAGGG - Intronic
902734365 1:18390489-18390511 ACCACAGCAGGCCTCCCCCAGGG + Intergenic
903509681 1:23865854-23865876 AGCAAAGGAGGAGGCCCAGAGGG + Intronic
903860907 1:26363991-26364013 CGCCCAGCAGGGGGCGCCCAGGG - Intronic
904473687 1:30751162-30751184 CTAAAAGCAGGAGGCCCCCATGG - Intronic
905344604 1:37302698-37302720 AGCTCAGCAGGAGCCCCTCAAGG - Intergenic
907301054 1:53486520-53486542 GGCACAGCAAGGGCCCCCCATGG - Intergenic
907515057 1:54988530-54988552 AGCCCAGCACCTGGCCCCCATGG + Intronic
907675014 1:56510151-56510173 ACCACAACAGCAGGCCCCCGCGG + Intronic
911736741 1:101344749-101344771 AACACAGAAGGAGGGACCCACGG + Intergenic
913937018 1:125064781-125064803 GGCAAAGCAGGAGCCCTCCATGG - Intergenic
913937329 1:125066490-125066512 GGCAAAGCAGGAGACCTCCATGG + Intergenic
914248296 1:145901734-145901756 GGCATAGCAGGAGGTCCCAAGGG + Intronic
915814469 1:158952039-158952061 AGCTAAGCAGGTGGGCCCCAGGG + Intronic
916168822 1:161985671-161985693 AGGACAGCAGGTGGGCCTCAGGG - Intronic
916573525 1:166047756-166047778 AGCACAGCAGCAGCCACTCAAGG - Intergenic
917587864 1:176446120-176446142 AGCACAGCAGAATGTCACCATGG + Intergenic
919287691 1:195585388-195585410 AGCACAGCACTGGGTCCCCAAGG - Intergenic
919981560 1:202645183-202645205 TGCTCAGCAGGAGGGCACCAGGG + Intronic
921114703 1:212078182-212078204 AGCACAGTAGGAGGTTGCCAGGG - Exonic
921472744 1:215567804-215567826 ACCAAAGGAGGAGGCCGCCAAGG - Intronic
921886785 1:220315073-220315095 AGCAGAGGATGAGGACCCCAGGG - Intergenic
1062933640 10:1369036-1369058 ACTACAGCAAGAGGCCGCCAGGG - Intronic
1063450691 10:6148125-6148147 AGCACAGGAGGTGGGCTCCAGGG - Intronic
1064049776 10:12049912-12049934 AGCACTTCAGGAGGCCGACACGG + Intergenic
1065528734 10:26647913-26647935 AGAAGAGCAGGAGTGCCCCATGG + Intergenic
1065572816 10:27089303-27089325 GGCATAGCAGATGGCCCCCAGGG + Intronic
1065796669 10:29314378-29314400 AGCACTGCAGGAGGCCAAGACGG + Intronic
1067088766 10:43256085-43256107 TGTGCAGGAGGAGGCCCCCAGGG + Intronic
1067247400 10:44558225-44558247 GGCAGAGCAGGAGGCACTCAAGG - Intergenic
1067700186 10:48565964-48565986 GGCCCTGCAGGAGGTCCCCATGG - Intronic
1072501500 10:96022844-96022866 TGCACAGCAGGAGGCCCTGAGGG + Intronic
1072705737 10:97679663-97679685 TGCGCAGGAAGAGGCCCCCAAGG - Exonic
1074107497 10:110399365-110399387 AGCACAGCAGGAGGCTCATTTGG + Intergenic
1075587809 10:123670000-123670022 GGCAGAGCAGGTGGGCCCCAGGG + Intronic
1076509202 10:131000058-131000080 GGCACAGCAGGAGGCCTCCAAGG + Intergenic
1076602943 10:131670737-131670759 AGCACCGCAGGAGGACACCATGG + Intergenic
1076864548 10:133160423-133160445 AGCCCAGCCGGAGGCCCCGGGGG + Intergenic
1076865882 10:133166089-133166111 GGCACTGCAAGAGGCCCCCCAGG - Intronic
1077065795 11:640396-640418 AGCACAGCAGGAAGGCCCCTGGG - Exonic
1077143690 11:1035683-1035705 AGCACAGTGGGACCCCCCCAGGG - Intronic
1077267652 11:1659999-1660021 AGCGCAGCAGGAGGCCACTGAGG + Intergenic
1080597126 11:33782970-33782992 AGCAGAGCATTAGGCCCTCAGGG - Intergenic
1081991735 11:47341608-47341630 GGCAGGGCAGGAGGCCACCAAGG - Intronic
1083083198 11:60114644-60114666 GGCAGAGCAGGTGGCCCCCAAGG - Intergenic
1083203361 11:61132984-61133006 AGCACAGCAGGAGGCCCCCAGGG - Intronic
1083488690 11:62999219-62999241 AGAACAGCAGGAAGACCCAACGG - Intronic
1083679517 11:64344713-64344735 CGCAGAGCAGGAGGCCCTCAGGG + Exonic
1084486362 11:69450481-69450503 AGCATGCCAGGAGGCCCACAGGG - Intergenic
1084621393 11:70272200-70272222 AGCGAAGCAGAAGGCCCCCCTGG + Exonic
1085047451 11:73362021-73362043 AGAACTGCAGGAGGCGCCAATGG - Exonic
1086514969 11:87601174-87601196 AGCACAGAAGGAGGCCGCATGGG + Intergenic
1090412411 11:126518400-126518422 AGAACAGAGGGAGGCCCCCGGGG - Intronic
1092255419 12:6924506-6924528 AGCAGAGCGGGAGGCCCGCAGGG - Exonic
1092264036 12:6967759-6967781 AGCCCAGCAGGAGGCCCAGCGGG - Exonic
1092619836 12:10251915-10251937 AGCACAGCAGGAGGTGAACAGGG - Intergenic
1094852920 12:34390300-34390322 GGCGCAGCAGAAGTCCCCCACGG + Intergenic
1095038426 12:37419057-37419079 GGCAAAGCAGGAGCCCTCCACGG - Intergenic
1096868603 12:54579383-54579405 GGCCCAGGAGGAGGCCCCGAGGG + Exonic
1097528423 12:60767701-60767723 AGAAAAGCAAGAAGCCCCCAAGG + Intergenic
1099988895 12:89701832-89701854 AGCACAGCATCTGGCCCCTAAGG + Intronic
1101759325 12:107645970-107645992 GACCCAGCAGGAGGCTCCCAGGG + Intronic
1101844240 12:108349660-108349682 AGCAGAGCAGGAGGCCCAGGTGG - Intergenic
1102456055 12:113071498-113071520 AGCACAGCAGGGTGCCCTGAAGG + Intronic
1103649519 12:122422298-122422320 AGCTCCGGAGGAGCCCCCCAGGG + Intronic
1103931117 12:124451625-124451647 CACACAGCAGGAGCCTCCCAGGG + Intronic
1103937223 12:124483092-124483114 TGCACAGCAGGCAGCCCCCTGGG - Intronic
1104417313 12:128606221-128606243 AGCACAGCAGGTGGCCTGCATGG - Intronic
1104631137 12:130403001-130403023 AGGACAGCAGGAGTCCCTCGGGG + Intronic
1104870930 12:131995078-131995100 AGAGCAGCAGGAGGCACACAGGG - Intronic
1104986622 12:132601047-132601069 AGCCCAGCAGGCAGCCCCCAGGG - Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1106218014 13:27720363-27720385 GGCACAGGAGGAGGACCTCAAGG - Intergenic
1106708804 13:32310070-32310092 AGAACAGCAGGCTGCCCCTAAGG - Intronic
1111232529 13:85363058-85363080 GGAGCAGCAGGGGGCCCCCACGG - Intergenic
1112864772 13:103880703-103880725 AGCACAGCAGAAAGCTGCCAGGG - Intergenic
1113893701 13:113749670-113749692 AGCACCTCACGGGGCCCCCAGGG - Intergenic
1116268831 14:42733549-42733571 ATCACAGCAGAACGCCCCCTTGG - Intergenic
1119028160 14:71170022-71170044 TGCACAGCAGCAGCCCCCAAGGG - Intergenic
1122561157 14:102615387-102615409 AGCACTGCAGGAGGCCACGATGG - Intronic
1123019035 14:105389010-105389032 AGCACAGCATGAGGCCCCGCCGG - Intronic
1123827592 15:24099294-24099316 AGCAACGCAGGAGGCACCCAGGG - Intergenic
1123841107 15:24247971-24247993 AGCAGGGCAGGAGGCAGCCAGGG - Intergenic
1123842048 15:24258676-24258698 AGCAAGGCAGGAGGCACCCGGGG - Intergenic
1123857065 15:24424754-24424776 AGCAAGGCAGGAGGCACCCGGGG - Intergenic
1123861697 15:24475282-24475304 AGCAAGGCAGGAGGCACCCGGGG - Intergenic
1124139096 15:27061850-27061872 AGCACAGCAGGATTTCCACACGG - Intronic
1124356796 15:29001456-29001478 AGCACTGCGGGAGGCCCACGTGG - Intronic
1124497247 15:30193919-30193941 TGCTCAGCAGGAGGGCACCAGGG + Intergenic
1124652627 15:31484694-31484716 GGCACAGCCGGAGTCTCCCACGG - Exonic
1124746327 15:32344728-32344750 TGCTCAGCAGGAGGGCACCAGGG - Intergenic
1125714479 15:41811578-41811600 AGCCCAGCAGGGGGCCCCCGGGG - Intronic
1126691094 15:51289549-51289571 AGCATTGCAGAAGGCCCCAAAGG - Intronic
1128551251 15:68599362-68599384 GGCACAGCAGGAGCACCCAATGG - Intronic
1129164968 15:73771723-73771745 AGCACAGCATCCGGGCCCCAGGG + Intergenic
1130020493 15:80226658-80226680 AGAGCAGCAGAAGGCCGCCAGGG - Intergenic
1130050551 15:80480333-80480355 AGCTCAGCAGGGGCCGCCCAAGG + Intronic
1130709841 15:86269077-86269099 AGCACCCCAGGAGGCCCTCAGGG - Intronic
1132870775 16:2114835-2114857 AGCAGTGCAGGAGGGCGCCAGGG + Exonic
1132913692 16:2329808-2329830 AGGACATCAGGAGGTGCCCAGGG + Exonic
1132934615 16:2474321-2474343 GGCACACCCGGAGGACCCCATGG + Intergenic
1133061220 16:3175533-3175555 GGCGCAGCAGGAGGCCCCCGAGG - Intergenic
1133212328 16:4270651-4270673 AGCATACCAGCAGTCCCCCAGGG - Intronic
1134090900 16:11391188-11391210 AGCACAGCACAGAGCCCCCAAGG - Intronic
1134950178 16:18347925-18347947 AGCAGTGCAGGAGGGCGCCAGGG + Intergenic
1135474310 16:22760809-22760831 AGCACCCCAGGTGGCCCCCAGGG - Intergenic
1136569179 16:31086661-31086683 GGCCCAGCAGGAGGCTCCAAAGG + Exonic
1136675007 16:31895049-31895071 AGCAAAGCAGAAGGCCCCCTGGG - Intronic
1137338055 16:47571259-47571281 AGGCCAGTAGGAGGCACCCATGG + Intronic
1137675037 16:50299915-50299937 AGCACAGGAGCAGAGCCCCACGG - Intronic
1138340638 16:56286931-56286953 AGCACAGCTGGTAGCCCCAATGG - Intronic
1138418047 16:56882517-56882539 ACCTCAGGAGGAGGCACCCAGGG + Intronic
1139435131 16:66932507-66932529 AGCAGCGCAGGAGGCAGCCAGGG - Intronic
1140650731 16:77085179-77085201 AAAACAGCAGGAGGCAGCCAAGG + Intergenic
1141692717 16:85605661-85605683 AGCACAGCCGGTGGCCCCCCCGG - Intergenic
1142074616 16:88110242-88110264 AGCCCAGGAGGCGGCCCCCCGGG - Intronic
1142200420 16:88758434-88758456 ATCACAGCAGGAGGAGCCCTGGG - Intronic
1142276828 16:89123195-89123217 AGCACAGCCTGAGGGCCTCAGGG + Intronic
1143220178 17:5255059-5255081 AGGACTGCAAGAGGCCCCAAGGG + Intergenic
1143588834 17:7867577-7867599 AGCACTGTGGGAGGCCCACACGG - Intronic
1144576619 17:16433747-16433769 TGCACTGCAGGGGGGCCCCAGGG - Intronic
1144665193 17:17097756-17097778 ACAGCAGCAGGAGGCACCCAGGG + Intronic
1145120508 17:20255323-20255345 AGCACAGCAGGAAGCCCACTTGG + Intronic
1145306809 17:21679923-21679945 GGCACAGCAGGAGCCCTCCGTGG - Intergenic
1145307039 17:21681085-21681107 GGCACAGCAGGAGCCCTCCGTGG - Intergenic
1145307267 17:21682250-21682272 GGCACAGCAGGAGCCCTCCGTGG - Intergenic
1145307954 17:21685745-21685767 GGCACAGCAGGAGCCCTCCGTGG - Intergenic
1145786448 17:27597059-27597081 AGCTGAGCAGGAGCCCCCCGGGG + Intronic
1145811455 17:27766685-27766707 ACCTCAGCAGGATGCCCCAAGGG - Intronic
1145817903 17:27808786-27808808 AGCAATGCAGGAGTTCCCCAGGG + Intronic
1146255297 17:31388808-31388830 AGGAAAGCAAGAGGTCCCCATGG - Intergenic
1146470433 17:33120192-33120214 ATCACAGCAGATGGGCCCCAGGG - Intronic
1146508063 17:33422544-33422566 AGCACAGCATGGAGCCGCCATGG - Intronic
1146643809 17:34563045-34563067 ATGACAGCAGGAGGCCGACAGGG - Intergenic
1146978740 17:37139694-37139716 GGCACTGCAGGAGACCCCTAAGG + Intronic
1147950739 17:44106349-44106371 ACAACCCCAGGAGGCCCCCAAGG + Intronic
1148465567 17:47863106-47863128 ACCACAGCAGGAGGGCCCTCTGG + Intergenic
1148485352 17:47987394-47987416 AGCCCAGCAGGAGGGCATCAAGG + Intergenic
1148807805 17:50273108-50273130 GACACAGCAGGAGGCGCCCAAGG + Intronic
1149624535 17:58070920-58070942 AGCTCTGCAGGAGGCACCGAGGG - Intergenic
1150225023 17:63519823-63519845 AGTAAAGCAGGAAGCCTCCAAGG + Intronic
1150421850 17:65043872-65043894 AGCACTGCAGGAGGCCAAGATGG + Intronic
1151551757 17:74826462-74826484 AGCACAGAAGCTGGCCCACATGG + Intronic
1151809027 17:76425116-76425138 AGCACTTCAGGAGGCCCAGACGG - Intronic
1152202895 17:78957449-78957471 AGAAGCCCAGGAGGCCCCCATGG + Intergenic
1152233937 17:79128719-79128741 GGCACAGCAGGAGTCCCCACAGG - Intronic
1152634068 17:81423308-81423330 AGCACAGCAGGAGCCTGCCAGGG + Intronic
1153096871 18:1417103-1417125 AGCACAGAAGGAGGCCAATATGG + Intergenic
1153096878 18:1417169-1417191 AGCACAGAAGGAGGCCAATATGG + Intergenic
1153482088 18:5556967-5556989 AGCACAGCTGGGGGGCCCCGGGG + Intronic
1153631670 18:7076347-7076369 CTCACATCAGGAGGCACCCAGGG - Intronic
1154168345 18:12032874-12032896 AGGACAGCAGGAGGCCCTGAGGG + Intergenic
1156298025 18:35810112-35810134 GGCTCAGCTGGAGGCCCCCAGGG - Intergenic
1156463962 18:37336992-37337014 AGCACAGCCGGAGGCGGCCAGGG - Intronic
1158679199 18:59551486-59551508 AGCACACCACGATGCCACCATGG + Intronic
1159025482 18:63179109-63179131 AGCACAGCATGAGTGCCCAATGG + Intronic
1159988939 18:74879386-74879408 CGCACAGCAGGCAGCACCCACGG + Intronic
1160221555 18:76981684-76981706 AGGCCGGCAGGAGGCCTCCACGG - Intronic
1160421933 18:78753849-78753871 AGCTCAGCAGGAGGCCTCCCGGG - Intergenic
1160421945 18:78753887-78753909 AGCTCAGCAGGAGGCCTCCCGGG - Intergenic
1160421957 18:78753925-78753947 AGCTCAGCAGGAGGCCTCCCGGG - Intergenic
1160421969 18:78753963-78753985 AGCTCAGCAGGAGGCCTCCCGGG - Intergenic
1160421981 18:78754001-78754023 AGCTCAGCAGGAGGCCTCCCGGG - Intergenic
1160421993 18:78754039-78754061 AGCTCAGCAGGAGGCCTCCCGGG - Intergenic
1160422005 18:78754077-78754099 AGCTCAGCAGGAGGCCTCCCGGG - Intergenic
1160422017 18:78754115-78754137 AGCTCAGCAGGAGGCCTCCCGGG - Intergenic
1160422029 18:78754153-78754175 AGCTCAGCAGGAGGCCTCCCGGG - Intergenic
1160422041 18:78754191-78754213 AGCTCAGCAGGAGGCCTCCCGGG - Intergenic
1160422053 18:78754229-78754251 AGCTCAGCAGGAGGCCTCCCGGG - Intergenic
1160422065 18:78754267-78754289 AGCTCAGCAAGAGGCCTCCCGGG - Intergenic
1160422075 18:78754305-78754327 AGCTCAGCAGGAGGCCTCCCGGG - Intergenic
1160422087 18:78754343-78754365 AGCTCAGCAGGAGGCCTCCCGGG - Intergenic
1160422099 18:78754381-78754403 AGCTCAGCAGGAGGCCTCCCGGG - Intergenic
1160422111 18:78754419-78754441 AGCTCAGCAAGAGGCCTCCCGGG - Intergenic
1160422122 18:78754457-78754479 AGCTCAGCAGGAGGCCTCCCGGG - Intergenic
1160422133 18:78754495-78754517 AGCTCAGCAGGAGGCCTCCCGGG - Intergenic
1160716775 19:580323-580345 AGCTCTGCAGGACGCCTCCAAGG - Intronic
1160809841 19:1008587-1008609 AACACAGCAGGAGCCCCGCACGG - Intronic
1162033958 19:7929401-7929423 AGGACAGCTAGAGGCTCCCAGGG + Intronic
1163111139 19:15161424-15161446 AGAAGAGCAGGAGGCCCCCCGGG - Exonic
1163361789 19:16851476-16851498 AGCACAGCAGGAAGCGCTCCCGG + Exonic
1163447033 19:17352919-17352941 GGCACAGCAGGAGTCCCTGATGG - Intronic
1163604114 19:18264894-18264916 AGCACACAAGGAGGCCAGCAGGG + Exonic
1163617746 19:18339962-18339984 AGGACAGGAGGAGGGCCCCTGGG + Intergenic
1164388238 19:27794717-27794739 AGGAAAGCAGGAGGCCCCCTGGG - Intergenic
1164484488 19:28643202-28643224 TCCAGAGGAGGAGGCCCCCAAGG - Intergenic
1164700469 19:30280867-30280889 ACCAAAGCAGGAGGCCACAAGGG - Intronic
1165342954 19:35225360-35225382 GGCACAGCTGGGGGCTCCCAGGG + Intronic
1165601240 19:37057077-37057099 GGCAAAGCAGGAGCCCTCCATGG + Intronic
1167068454 19:47204862-47204884 AACACACCAGGAGCCCCTCAAGG + Intronic
1167981720 19:53281656-53281678 AGCAGAGCAGGAGGAATCCAGGG + Intergenic
1167984372 19:53302006-53302028 AGCAGAGCAGGAGGAATCCAGGG - Intergenic
1168404297 19:56102889-56102911 GGCAGAGAAGGTGGCCCCCAGGG + Intronic
925263115 2:2545316-2545338 AGCACAGCAGGGGTCCCCCGTGG + Intergenic
925353892 2:3223703-3223725 AGCCCTGTAGGTGGCCCCCAGGG + Intronic
925532827 2:4883648-4883670 TGCACAGCAGGGGGCCAGCATGG + Intergenic
926616697 2:15002964-15002986 AGCCCAGAAGGGGGCTCCCACGG + Intergenic
927496976 2:23557617-23557639 GGCCCAGCAGGTGGTCCCCAAGG + Intronic
933284088 2:80365918-80365940 AGGAGAGCAGCAGGCCCCGAGGG - Intronic
933288963 2:80415262-80415284 AGAATAACAGGAGGCTCCCATGG - Intronic
933749380 2:85593315-85593337 AGTACAGCAGGCTGCCCTCAAGG - Exonic
934709934 2:96508239-96508261 AGTACTGCAGGAGGCGCCGAGGG + Intergenic
934763062 2:96866831-96866853 AGCAGAGCAGGAGGCACAGACGG + Intronic
936010216 2:108920793-108920815 AGCACATCATGAGTGCCCCAGGG - Intronic
936058999 2:109282463-109282485 AGCACTGCAGGAAGGCCCGAGGG + Intronic
936161295 2:110085941-110085963 AGGACACCAGGACGGCCCCAGGG - Intronic
936183368 2:110285413-110285435 AGGACACCAGGACGGCCCCAGGG + Intergenic
937985616 2:127636880-127636902 CGCACAGCAGGCGGCTGCCACGG - Exonic
938381632 2:130839437-130839459 AGCCCAGGAGGAGGACCCCAAGG + Intronic
940848865 2:158669792-158669814 AGCACAGCAGATGGCTGCCATGG - Exonic
942205895 2:173619819-173619841 AGCACAGCAGGAGAGGCACACGG - Intergenic
945521486 2:210833064-210833086 AGGACAGTAGGAGGTACCCATGG + Intergenic
947621316 2:231593006-231593028 AGCCCAGCAGGAGAGCCCCAAGG + Exonic
948557312 2:238822196-238822218 AGCTGAGCAGGAGGCTCCCCAGG + Intergenic
948915557 2:241033558-241033580 AGCAGAGGATGAGGCCACCAAGG + Intronic
949009890 2:241672376-241672398 AGCACAGCGGGTGGCCCTCTGGG - Exonic
1170830007 20:19832123-19832145 AGCACAGCAGGTGGTGCCCTCGG - Intergenic
1171462600 20:25307355-25307377 AGAACAGCATGAGGCCAGCATGG + Intronic
1171570985 20:26251533-26251555 AGCAAAGCAGGAGTCCGCCTGGG - Intergenic
1173838111 20:46138900-46138922 GGCACAGCAGGGGGCCTCCACGG - Intergenic
1176051405 20:63121448-63121470 AGCCCAGCACGGCGCCCCCACGG + Intergenic
1176305694 21:5122003-5122025 GGTGCAGCAGGAGGCCACCAGGG + Intronic
1176342168 21:5709299-5709321 AGCAGAGCAGGCGGCTCCCTGGG + Intergenic
1176474422 21:7141451-7141473 AGCAGAGCAGGCGGCTCCCTGGG + Intergenic
1176502659 21:7615157-7615179 AGCAGAGCAGGCGGCTCCCTGGG - Intergenic
1176536489 21:8107368-8107390 AGCAGAGCAGGCGGCTCCCTGGG + Intergenic
1178773662 21:35528732-35528754 AGCAGTGCTGGAGGCCCCCGGGG - Intronic
1179102007 21:38362205-38362227 AGCACACCAGGAGACACCAAAGG + Intergenic
1179396582 21:41045768-41045790 AGCAAAGCACGGGGCCTCCACGG - Intergenic
1179851363 21:44140028-44140050 GGTGCAGCAGGAGGCCACCAGGG - Intronic
1180705112 22:17804706-17804728 AGCACAGCACTCGGCCGCCATGG + Intronic
1181432016 22:22887654-22887676 TGCCCAGCAGGAGTCCCCAAGGG - Intronic
1181512811 22:23396304-23396326 AGCAGCCCAGGAGGCACCCAAGG + Intergenic
1181542504 22:23580730-23580752 TGCCCAGCAGGAGTCCCCCAGGG + Intergenic
1181689483 22:24550620-24550642 GGCACAGCAGGAGGGCTCCTGGG - Intronic
1184308810 22:43628008-43628030 TGCACCCCAGGAGGCCCCCTCGG - Intronic
1184367640 22:44062724-44062746 AGAACAGGAGGAGGCACACAGGG + Intronic
1184716853 22:46287412-46287434 AGCACAGCAGGTGCCGCCCTGGG - Intronic
1185249871 22:49795569-49795591 AGCACAGGAGCAGGGCCCTAGGG + Intronic
1203241434 22_KI270733v1_random:23780-23802 AGCAGAGCAGGCGGCTCCCTGGG + Intergenic
951725575 3:25754595-25754617 AGCTCTGCAGTAGTCCCCCATGG - Intronic
953982308 3:47418882-47418904 AGCACAGCAGGAGGAAGCCCTGG - Intronic
954130595 3:48558787-48558809 AGCTCATCAGGAGCCGCCCATGG - Intronic
954416309 3:50395098-50395120 AGCTCTGCAGAAGGCCCCCGAGG - Intronic
956873700 3:73442119-73442141 AGCCCAGCAGGGAACCCCCAGGG - Intronic
957588188 3:82159702-82159724 ACCGCAGCAGGAGGACACCAGGG - Intergenic
960259287 3:115547298-115547320 AGCGCAGCAGGGTGACCCCAAGG - Intergenic
960733008 3:120746546-120746568 AGCACTTTAGGAAGCCCCCAAGG + Intronic
961427329 3:126858454-126858476 AGCCCAGCAGGGGTGCCCCATGG + Intronic
961771468 3:129253098-129253120 AGCACACCTGGAGGCTGCCATGG - Intronic
962315582 3:134357538-134357560 AGCTCAGGAGGAGGACCCCAGGG - Exonic
962873676 3:139519481-139519503 AGCTCATCAGGAGGGCACCAGGG + Intronic
962903224 3:139778882-139778904 TGAGCATCAGGAGGCCCCCAAGG - Intergenic
967390492 3:188949464-188949486 AGGAAAGCAGGAGGCGTCCATGG - Intronic
968627558 4:1634023-1634045 AGAACACCAGGAGGGGCCCAGGG + Intronic
968792290 4:2674561-2674583 AGCACAGCAGAAACTCCCCAAGG - Intronic
969297531 4:6278659-6278681 ACCACAGCAGGGAGGCCCCACGG - Intronic
969509639 4:7610448-7610470 AGCTCTGCACGAGGCCCCCCGGG + Intronic
969637087 4:8375496-8375518 CGCCCACCAGGAGGCCCCCAAGG + Intronic
970123636 4:12784879-12784901 AGCAGAGCAGGAGGTTCTCACGG - Intergenic
970520999 4:16883696-16883718 AGCCTGGCAGGAGGACCCCACGG - Intronic
974079542 4:57197924-57197946 ATGACAGGAGCAGGCCCCCATGG + Intergenic
979134428 4:117091212-117091234 AGCAAAGCAGGAGTCCCACTTGG + Intergenic
979669026 4:123343071-123343093 AGCACACCAGGAGGGAGCCAAGG + Intergenic
982064811 4:151644808-151644830 AGCACCACAGGAGGGCGCCAGGG - Intronic
982313516 4:154009333-154009355 AGCACAGCAGGCAACCGCCAGGG + Intergenic
984928532 4:184826615-184826637 CGCACAGCAGGTGGCCGCCGTGG - Exonic
984948785 4:184990517-184990539 AGCCCAGAAGGGGGCTCCCACGG + Intergenic
985381440 4:189399080-189399102 AGCAGAGCAGGCTGCCCCCAGGG - Intergenic
985403934 4:189617074-189617096 AGCCCAGAAGGGGGCTCCCACGG + Intergenic
985517772 5:355750-355772 AGGGCAGCAGGAGGCACGCAGGG - Intronic
986819308 5:11447590-11447612 GGCACAGCAGGTGGCCTCCAGGG - Intronic
987495536 5:18639107-18639129 AGCACTTCAGGAGGCCAACATGG + Intergenic
987916857 5:24226592-24226614 AGCACAGTAGGAGGTGTCCATGG + Intergenic
990862389 5:60341320-60341342 AGAGCAGCAGGAGGAGCCCAGGG - Intronic
992730996 5:79668978-79669000 AGCCCAGTAAGAGGTCCCCAAGG - Exonic
993996180 5:94726183-94726205 AACACAACTGGAGGCACCCAAGG - Intronic
995882188 5:116855098-116855120 AGCACACCAGGAGGCCGCCGAGG - Intergenic
1001591200 5:172866547-172866569 AGCACAGCGCCTGGCCCCCATGG - Intronic
1001807207 5:174597180-174597202 AGCACTTCAGGAGGCCAACATGG + Intergenic
1002302819 5:178267145-178267167 AGCACCGGTGGAAGCCCCCAGGG - Intronic
1002465470 5:179406165-179406187 AGCCCACCAGGAGGCCCCGGGGG + Intergenic
1003460691 6:6325122-6325144 AGCTCAGCATGAGACCTCCAAGG + Intergenic
1003466942 6:6389693-6389715 AGCACATCAGCAGGCACTCAAGG + Intergenic
1003770216 6:9290864-9290886 AGCCCAGAAAGAGGCTCCCAGGG + Intergenic
1005749254 6:28867955-28867977 AACACTGCAGGAGTCCCCAAAGG + Intergenic
1010047975 6:71469765-71469787 AGCACAGAAGGAGGAACACAGGG - Intergenic
1012283938 6:97365540-97365562 AGCACAGCAGGATGCTGACATGG + Intergenic
1013191710 6:107809430-107809452 AGCAGGGCAGGAGGCCATCATGG + Intronic
1015288580 6:131511619-131511641 AGCACAGTAGCAGGCCCACCAGG + Intergenic
1015867400 6:137741047-137741069 AGGACAGCAGGTGGCCTGCAGGG - Intergenic
1017929368 6:158939028-158939050 GCCACAGCCGGGGGCCCCCAAGG - Intergenic
1018172358 6:161152730-161152752 AGCACAGGAAGCCGCCCCCAGGG + Intronic
1018704220 6:166450767-166450789 ACCACCACAGGAGGCCACCATGG + Intronic
1018726128 6:166614719-166614741 AGGAACGCAGGTGGCCCCCAGGG - Intronic
1018733957 6:166673460-166673482 AGGGCACCAGGAGCCCCCCAGGG - Intronic
1019492488 7:1321856-1321878 AGGGCAGCAGGAGCCTCCCACGG + Intergenic
1019599817 7:1875556-1875578 AACACAGCAGGTGGCCCACACGG + Intronic
1020083775 7:5299702-5299724 AGCACAGGAGGATGCCCCAGAGG + Intronic
1022453499 7:30537436-30537458 AGCACCGGAGGGGGTCCCCATGG + Intronic
1023159301 7:37282189-37282211 AGGACAACAGGAGGTCCACAGGG + Intronic
1024035280 7:45502964-45502986 AGCAAAGCAGGAGTCCACCCTGG + Intergenic
1024656073 7:51452196-51452218 AGAACAGCAGCAGCCTCCCATGG - Intergenic
1025110383 7:56211529-56211551 AGCACAGGAGAAGGCCCCTCAGG + Intergenic
1025210505 7:57017483-57017505 AGCACAGGAGGATGCCCCAGAGG - Intergenic
1025284508 7:57651132-57651154 GGCAAAGCAGGAGCCCTCCATGG - Intergenic
1025661451 7:63559364-63559386 AGCACAGGAGGATGCCCCAGAGG + Intergenic
1025709961 7:63899922-63899944 AGCACCGCAGGAGTGCCCCTTGG - Intergenic
1027192325 7:76003925-76003947 ATCACAGCAGAAGGGCCACAGGG + Intronic
1029187109 7:98747088-98747110 AGCAGAGCAGGAGGACCACCAGG + Intergenic
1029926905 7:104328412-104328434 AGCAGAGCGGGAGGCGCCCCGGG + Intergenic
1029995261 7:105001235-105001257 ACCAGGGAAGGAGGCCCCCAGGG + Intergenic
1030246300 7:107387403-107387425 AGCTGAGCAGGTGGGCCCCAGGG - Intronic
1031995092 7:128225355-128225377 AGCACAGCAGCATCACCCCAGGG - Intergenic
1032648134 7:133848266-133848288 AGAAGAGGAGGATGCCCCCAGGG + Intronic
1032840025 7:135706061-135706083 AGCCAGGCAGGAGGACCCCAGGG + Intronic
1034132706 7:148735270-148735292 AGCACAGCCGCAGGCTCCAAGGG - Intronic
1034295540 7:149968879-149968901 AACACAGGAGCAGGCCCACATGG - Intergenic
1034335973 7:150323623-150323645 GGCCCAGCAGGTGGCCCCCCGGG - Intronic
1034563472 7:151896076-151896098 ATGACAGCAGAGGGCCCCCAAGG - Intergenic
1034810519 7:154128051-154128073 AACACAGGAGCAGGCCCACATGG + Intronic
1038021815 8:23557488-23557510 ATCACAGCAGGAGGCCCAGGAGG - Intronic
1038207601 8:25482078-25482100 AGCTCAGCAGGAGACAGCCAGGG - Intronic
1038320094 8:26517904-26517926 AGCACAGCACTGGGCTCCCAGGG - Intronic
1039957580 8:42219090-42219112 AGCACAGCTGGAGGACCCCAGGG - Intergenic
1040552683 8:48450660-48450682 CGGGCAGCAGGAGCCCCCCAGGG + Intergenic
1041030281 8:53729549-53729571 AGCACATCATGTGGCCCCCAGGG - Intronic
1043819944 8:84850460-84850482 AGGACAGTAGGAGGCCACAAAGG + Intronic
1044611644 8:94097897-94097919 AGCACCGCTGGGGGCTCCCAGGG - Intergenic
1044842597 8:96349912-96349934 GCCACAGCTGGAGGCCCCCTCGG - Intergenic
1045507653 8:102789841-102789863 AGCACTTCAGGAGGCCAACATGG + Intergenic
1046754793 8:117962316-117962338 GGCACAGCACCAGGCCCCCTTGG - Intronic
1046962251 8:120124329-120124351 TGAAGAGCAGGAGGCCACCAGGG - Intronic
1047770304 8:128025266-128025288 AGCCCAGCAGCTGGCCCCCGAGG - Intergenic
1048971325 8:139646452-139646474 AGCATGGAAGGAGGCCTCCAGGG + Intronic
1049397908 8:142410239-142410261 AACACAGCATGATGCCCTCAGGG + Intergenic
1049416593 8:142498242-142498264 AGCAGAGCAGAAGCCCCCGAGGG + Intronic
1049603460 8:143518641-143518663 AGCCCTGGAGGAGGCCCTCAGGG - Intronic
1049627926 8:143634581-143634603 ATCACAGCAGGAGTTCCACATGG + Intergenic
1049688522 8:143948879-143948901 AGGACAGCAGGAAGGCCACATGG + Intronic
1051372225 9:16368393-16368415 AGCCCAGCAGGTGCCACCCATGG + Intergenic
1051531233 9:18106061-18106083 AGCAGAGCAAGAAGCTCCCAGGG - Intergenic
1051714530 9:19968230-19968252 AGCACACCAGGGAGCCCACAGGG + Intergenic
1052254083 9:26433127-26433149 AGGACAGTAGGAGGCCCTCTAGG + Intergenic
1053475187 9:38377508-38377530 AGCCCAGAAGGGGGCTCCCACGG - Intergenic
1055975265 9:81949104-81949126 GGCACAGCAGCAGGAGCCCAGGG + Intergenic
1057447166 9:95124722-95124744 AGGTCAGCAGGAGGCACCCTGGG - Intronic
1057562749 9:96140891-96140913 AGCACTGCAGGAGGAGGCCAAGG - Intergenic
1060309189 9:122444187-122444209 AGCCCAGCAGGAGCCCATCATGG - Intergenic
1061158962 9:128882376-128882398 AACACCGCGGGAGGTCCCCAGGG - Intronic
1061348439 9:130044374-130044396 AGCACATCAGGAGGCCCAGGTGG + Intergenic
1061789098 9:133049181-133049203 ACCACAGCCTGAGGCCACCATGG + Intronic
1061913873 9:133738945-133738967 TGCACAGCACGTAGCCCCCAGGG + Intronic
1062596887 9:137303549-137303571 AGCCCACCAGGAGGACCCCAGGG - Intergenic
1203457755 Un_GL000220v1:6853-6875 AGCAGAGCAGGCGGCTCCCTGGG + Intergenic
1203669104 Un_KI270754v1:36279-36301 TGCACAGCAGGAGCCCTCCGTGG - Intergenic
1186423152 X:9442990-9443012 AGTACAGAGGGTGGCCCCCAAGG + Intergenic
1186862686 X:13689184-13689206 TGCACAGCAGGAGGCAGCCGCGG - Exonic
1187707065 X:22019582-22019604 AGCTGAGAAGGAGACCCCCATGG - Intergenic
1189236099 X:39488583-39488605 ATCAGAGCTGGAGGCCACCAAGG - Intergenic
1192165294 X:68824091-68824113 AGCCCAGCAGGAGGCAGCCTAGG - Intergenic
1198313105 X:135438796-135438818 ACCTCAGCTCGAGGCCCCCAAGG - Intergenic
1200357371 X:155565892-155565914 AGCAATGCAGGAGACCCCCACGG - Intronic