ID: 1083204082

View in Genome Browser
Species Human (GRCh38)
Location 11:61137532-61137554
Sequence CATATTAAGCACTGTGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083204082_1083204085 21 Left 1083204082 11:61137532-61137554 CCATGCTCACAGTGCTTAATATG 0: 1
1: 0
2: 1
3: 18
4: 161
Right 1083204085 11:61137576-61137598 GCTGCACTGTGCCCAGCACCAGG 0: 1
1: 0
2: 9
3: 74
4: 511
1083204082_1083204088 30 Left 1083204082 11:61137532-61137554 CCATGCTCACAGTGCTTAATATG 0: 1
1: 0
2: 1
3: 18
4: 161
Right 1083204088 11:61137585-61137607 TGCCCAGCACCAGGCTGGGCAGG 0: 1
1: 0
2: 7
3: 70
4: 477
1083204082_1083204086 25 Left 1083204082 11:61137532-61137554 CCATGCTCACAGTGCTTAATATG 0: 1
1: 0
2: 1
3: 18
4: 161
Right 1083204086 11:61137580-61137602 CACTGTGCCCAGCACCAGGCTGG 0: 1
1: 2
2: 11
3: 113
4: 693
1083204082_1083204084 -6 Left 1083204082 11:61137532-61137554 CCATGCTCACAGTGCTTAATATG 0: 1
1: 0
2: 1
3: 18
4: 161
Right 1083204084 11:61137549-61137571 AATATGTGACAAAGGAACGCAGG 0: 1
1: 0
2: 0
3: 6
4: 140
1083204082_1083204087 26 Left 1083204082 11:61137532-61137554 CCATGCTCACAGTGCTTAATATG 0: 1
1: 0
2: 1
3: 18
4: 161
Right 1083204087 11:61137581-61137603 ACTGTGCCCAGCACCAGGCTGGG 0: 1
1: 0
2: 8
3: 79
4: 609

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083204082 Original CRISPR CATATTAAGCACTGTGAGCA TGG (reversed) Intronic
909877374 1:80824742-80824764 CATATTAAGCAACTTGACCATGG + Intergenic
910085544 1:83397880-83397902 CCTGTTAATCACTGTAAGCATGG + Intergenic
910505423 1:87945285-87945307 CATGTAAAGCACTGAGAACAGGG - Intergenic
911186860 1:94912926-94912948 CATAATCAGCACAGTGGGCATGG - Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
913217829 1:116635381-116635403 CATATTAAGAAATGAGAGAAGGG - Intronic
919337478 1:196255960-196255982 CATGTTAATCACTCTGGGCAAGG + Intronic
919587347 1:199455233-199455255 CATATGAAGGACTCAGAGCAGGG - Intergenic
1062912182 10:1218550-1218572 CATATCAAGCACTGTCAGTGGGG - Intronic
1066306417 10:34147496-34147518 CATATTAAGCAATTTGAGTCTGG - Intronic
1067053435 10:43038192-43038214 CACAATAAGCACAGTGAGCTTGG - Intergenic
1068091736 10:52440533-52440555 CAAATCAAGCACTTTGACCAGGG - Intergenic
1068530275 10:58178313-58178335 CATTCTAAGCTCTGTGAGCTTGG + Intergenic
1069162422 10:65108121-65108143 CACTTTAATCACTGTGATCATGG - Intergenic
1071489859 10:86128866-86128888 CATGTCAAGCACTGTGAGAAAGG + Intronic
1072018065 10:91369584-91369606 CCTATTAAGCATTTTCAGCAGGG + Intergenic
1072641649 10:97215607-97215629 CATATTAAGCACTGGAAACGTGG - Intronic
1072830600 10:98654051-98654073 GATATGAAGCAATGTGAACAAGG - Intronic
1073068445 10:100778424-100778446 CATATCCAGCACTGTGAGCTAGG + Intronic
1073354057 10:102839859-102839881 CACTTTAATCACTGTGATCATGG - Intergenic
1074024137 10:109616108-109616130 CATATTAAGAAGTGTGGGCCAGG - Intergenic
1074217913 10:111405869-111405891 CCTATTCAGCATTGTGAGGAGGG - Intergenic
1075219380 10:120571466-120571488 CATTTTACACACTGTGAGGAGGG - Intronic
1075219601 10:120573156-120573178 CATTTTACACACTGTGAGGAGGG + Intronic
1076256943 10:129034400-129034422 CATATTAACCACTGTACGAAAGG + Intergenic
1077564987 11:3291983-3292005 CCGAGCAAGCACTGTGAGCAGGG - Intergenic
1077570873 11:3337800-3337822 CCGAGCAAGCACTGTGAGCAGGG - Intergenic
1082556423 11:54567986-54568008 CATACTAAGCACTATGTGCTAGG - Intergenic
1082572930 11:54764485-54764507 CACTTTAATCACTGTGATCATGG + Intergenic
1083204082 11:61137532-61137554 CATATTAAGCACTGTGAGCATGG - Intronic
1085064494 11:73481511-73481533 CATATTAAAAATTGTGATCAGGG + Intronic
1086326016 11:85700446-85700468 CATAGTAAATACTGTGAGAAGGG + Intronic
1086592548 11:88533238-88533260 TAGATGAAGCAATGTGAGCAAGG - Intronic
1087925928 11:103918614-103918636 TATATTAAGCAACGTGAGCACGG + Intronic
1088765912 11:112977820-112977842 CATATTAATCACTCTGTGAAAGG + Intronic
1098879584 12:75903419-75903441 CACATTAATAACCGTGAGCATGG + Intergenic
1099624484 12:85051484-85051506 CTTATTAAGCATTTTGAGCTAGG - Intronic
1101484069 12:105133183-105133205 TACCTGAAGCACTGTGAGCAGGG - Intronic
1101759045 12:107644254-107644276 CATCTTGAGCACTGTGTGTAAGG + Intronic
1104104796 12:125649296-125649318 CATATTCACCACTCTGAGCCTGG + Intronic
1104122308 12:125811272-125811294 CATAATGGGCACTGTCAGCAGGG - Intergenic
1108684237 13:52804876-52804898 CAAATTATGCAGTGTGGGCATGG - Intergenic
1109418011 13:62069787-62069809 TATATTAAGAAATGTGAGCCCGG + Intergenic
1110178401 13:72585389-72585411 CATATTACTCTCTGAGAGCATGG + Intergenic
1111485627 13:88895554-88895576 CAGAGTGAGCACTGGGAGCAGGG - Intergenic
1111600448 13:90467504-90467526 CACATTAAGAACTGAGAGAAAGG - Intergenic
1111786469 13:92793375-92793397 CATTTAAAGCAGTGTGTGCAGGG + Intronic
1116862721 14:50007493-50007515 CATAGTTACCACTGGGAGCAGGG - Exonic
1117027534 14:51636773-51636795 CCCATTAAGCACTGTGAGAGGGG + Intronic
1117695132 14:58354215-58354237 CATATTACTGACTATGAGCAGGG + Intronic
1118379583 14:65206834-65206856 GATATTAAGCAGTGTGCTCAGGG + Intergenic
1121064791 14:90952450-90952472 CACTTTAATCACTGTGATCATGG + Intronic
1121443936 14:93966880-93966902 CATATTAATCTCATTGAGCAGGG - Intronic
1121679784 14:95783880-95783902 AATATTCAGCACAGTGAACAAGG + Intergenic
1122024912 14:98868718-98868740 CATACAAAGCACTTAGAGCAGGG + Intergenic
1122125666 14:99577184-99577206 TTTATTAAGCACCGTGGGCAGGG - Intronic
1122252647 14:100450821-100450843 CAGATTAAGCACACTGAGGAGGG + Intronic
1123849788 15:24343076-24343098 AACATTAAGCACCGTAAGCATGG + Intergenic
1125811569 15:42546605-42546627 AATATTAAACACTGTGAGACTGG - Intronic
1127539492 15:59922706-59922728 CATATTAAGGACTCTGAGCCCGG - Intergenic
1128502299 15:68235092-68235114 CACATTAAGCACTGAGATCAGGG - Intronic
1134376582 16:13681291-13681313 CAAAATAAACACTGAGAGCAAGG - Intergenic
1135844611 16:25907656-25907678 CTAATCAAGCACTTTGAGCAGGG - Intronic
1137707480 16:50545581-50545603 CTTTCTAAGCACTGTGAGAAAGG + Intergenic
1137809610 16:51340230-51340252 CATAATATCCACTGTGTGCAAGG - Intergenic
1145102409 17:20088053-20088075 CACATGAAGCACAGTGAGCAGGG + Intronic
1145801370 17:27687936-27687958 CACTTTAATCACTGTGATCATGG - Intergenic
1145991754 17:29083229-29083251 CCGATGAAGCACTGTGAGCAAGG - Intronic
1146714526 17:35073538-35073560 CATATGAAGTCCTGTGAGGATGG - Intronic
1146714574 17:35074182-35074204 CATATGAAGTCCTGTGAGGATGG + Intronic
1150391959 17:64795136-64795158 AATATTTAACACTGAGAGCAAGG + Intergenic
1153739048 18:8103826-8103848 ATTATTAAGCACAGTGAGGAAGG - Intronic
1157761638 18:50269624-50269646 CATATTTAACTCTGTGAGGAAGG + Exonic
1161624152 19:5316194-5316216 CAGATTAGCCACTGTGAGAAAGG + Intronic
1163941730 19:20501482-20501504 CACTTTAATCACTGTGATCATGG - Intergenic
1165096182 19:33411114-33411136 TCTATGAAGAACTGTGAGCACGG + Intronic
1165604671 19:37091628-37091650 CATATTAAGAACTTTGGGCTGGG + Intronic
1165604765 19:37092415-37092437 CATATTAAGAACTTTGGGCTCGG + Intronic
1165808331 19:38595746-38595768 GGTTTTAAGAACTGTGAGCAAGG + Intronic
926868393 2:17385595-17385617 CATCTTCATCACTGTGACCAGGG - Intergenic
929199031 2:39216033-39216055 CATGTTGAGCACTGTGAGACAGG + Intronic
933798290 2:85938858-85938880 CATGTTAAGCACTGTGTCTAAGG + Intergenic
935353159 2:102172719-102172741 TATATTAAGCACTGTGATGAGGG - Exonic
936606330 2:113959777-113959799 GATATCAAGCAACGTGAGCATGG + Exonic
937966141 2:127512707-127512729 CATACCAAGCACTGAGAGGAAGG - Intronic
938908397 2:135861420-135861442 CATATACAGCACTGAGAACATGG + Intronic
939952519 2:148491643-148491665 TATATTAGGCATTATGAGCAAGG - Intronic
942366236 2:175230770-175230792 AATAATAAACACTGTGAACAAGG - Intergenic
942565226 2:177259490-177259512 TATATTAAGAACTTTGAGTAGGG - Intronic
942694121 2:178619677-178619699 GATATTAAGCCCCGTGACCAGGG - Exonic
943316233 2:186391483-186391505 CATCTTAAGTACAATGAGCAAGG + Intergenic
945198351 2:207257920-207257942 GATAGTCAGCACTGTGGGCAGGG - Intergenic
947384047 2:229572570-229572592 CATATAAAGCACTGTGCTAAAGG + Intronic
947452069 2:230217718-230217740 CATAGTTAGCACTGTAAGCCTGG - Intronic
948301406 2:236909820-236909842 CATGTGAAGTGCTGTGAGCAGGG - Intergenic
1170797944 20:19565989-19566011 CATATCAAGCACTGAGCCCAGGG + Intronic
1173599433 20:44282728-44282750 CATATTAGGAACTGTGCACACGG + Intergenic
1174034527 20:47660249-47660271 CATATTAGTCACTGTGTGCCAGG - Intronic
1174526428 20:51175724-51175746 CAGATTCAGCACATTGAGCAAGG + Intergenic
1180819131 22:18813451-18813473 CATATTAAGAAATGAGAGAAGGG - Intergenic
1181205355 22:21247899-21247921 CATATTAAGAAATGAGAGAAGGG - Intergenic
1181314071 22:21960729-21960751 CAGAATAAGCACTGTGACCTTGG - Intronic
1181932683 22:26415428-26415450 GATAATAAGCACTGTGAGAAAGG + Intergenic
1183312148 22:37116065-37116087 CATATTAAGCAGGGTGAGGCAGG + Intergenic
1203221570 22_KI270731v1_random:47517-47539 CATATTAAGAAATGAGAGAAGGG + Intergenic
1203269256 22_KI270734v1_random:39304-39326 CATATTAAGAAATGAGAGAAGGG - Intergenic
949460967 3:4293697-4293719 CATATTCAGCAGTGAGATCAAGG + Intronic
951879654 3:27467674-27467696 CAAATTAAGCAGTGTGAACTCGG - Intronic
955039118 3:55297879-55297901 CATATTAAGCACTCTCAGGAAGG - Intergenic
955135099 3:56209373-56209395 CAGAATAAGGACTGTGACCAAGG - Intronic
955868377 3:63410098-63410120 CATATTAATCACAATGAGCAAGG - Intronic
957272886 3:78054406-78054428 CATACTAGGCACTTTGAACATGG + Intergenic
958089869 3:88862983-88863005 CATATTAAGCACTATGATCAAGG + Intergenic
958621826 3:96572437-96572459 CATATAAAGCAGTGTGTACAGGG - Intergenic
959389807 3:105759682-105759704 CAGAGCAGGCACTGTGAGCAGGG + Intronic
964767654 3:160194090-160194112 AATATTAGACACTGGGAGCAGGG + Intergenic
965809032 3:172573812-172573834 CATATTTGGTACAGTGAGCAGGG + Intergenic
966461269 3:180179604-180179626 CATTTTAAGCAATATGAACAAGG - Intergenic
970328534 4:14954716-14954738 CATCTGAAGCACTGTAAGCATGG + Intergenic
970492441 4:16588229-16588251 CAGATTTAGCACTGTGATCAGGG + Intronic
974232923 4:59139645-59139667 CACATTAAGCACTGATAGAAGGG + Intergenic
975552293 4:75626107-75626129 CATATTAGTCACTGTGTTCATGG + Intronic
978389651 4:108212058-108212080 TTTATTGAGCACTGTCAGCAAGG + Intergenic
983119076 4:163858169-163858191 CATATTAAACACCATGAGCATGG + Intronic
983190815 4:164751595-164751617 CACTTTAATCACTGTGATCATGG + Intergenic
984891818 4:184500947-184500969 TATGCTAAGCACAGTGAGCAGGG - Intergenic
985135493 4:186781698-186781720 CAATTGAAGCACTGTTAGCAGGG - Intergenic
986146600 5:5083596-5083618 CAGATTTGGCACAGTGAGCAGGG + Intergenic
987917914 5:24240111-24240133 ACTATTAAACACTGAGAGCAAGG - Intergenic
990058136 5:51611470-51611492 GATATTAAGTACTGGGAGAAAGG - Intergenic
993588832 5:89767725-89767747 TTTATTAAGCAGTGTGAGAATGG + Intergenic
993702578 5:91135808-91135830 CATAATAAGGACTGTGAACAGGG + Intronic
995074314 5:107963745-107963767 CACATTTAGCTCTGGGAGCATGG + Intronic
995597552 5:113764176-113764198 CACATTAAGCCCTGTGAGAGTGG + Intergenic
998798967 5:145848824-145848846 CTTCTTCAGCTCTGTGAGCAAGG + Intergenic
999632404 5:153584367-153584389 CATCTCAAACACTGTGGGCAAGG - Intronic
1000350819 5:160351043-160351065 AATATTTAGCACTGTGGGCCAGG - Intronic
1010160773 6:72852085-72852107 CATTTTAAACACTGTTAGGAAGG - Intronic
1010492060 6:76488533-76488555 CACTTTAATCACTGTGATCATGG - Intergenic
1010997091 6:82546155-82546177 CATATAAAGCAGTGTGTGGAGGG - Intergenic
1012126613 6:95436460-95436482 CATAGTAAGCACTGAGTGAACGG + Intergenic
1013759901 6:113505863-113505885 CATATAAAGTACTGAGAGCCTGG + Intergenic
1017295496 6:152789301-152789323 CAGATTAAACACTGTGGGCATGG + Intergenic
1021481514 7:21122688-21122710 CATATAAACCACTGTGAGGTGGG - Intergenic
1024130417 7:46346485-46346507 CATATTAAGTACTCAGAGTATGG - Intergenic
1024938366 7:54736289-54736311 CATATTAAGCAGTGTGTAGAGGG - Intergenic
1026065932 7:67072791-67072813 CATATTAAGCCCTGTCACCTAGG + Intronic
1026280174 7:68915184-68915206 CTTATTAACCACTGTGGGAATGG - Intergenic
1026586644 7:71661091-71661113 CATTGTAACCACAGTGAGCAGGG - Intronic
1026710949 7:72739058-72739080 CATATTAAGCCCTGTCACCTAGG - Intronic
1029878024 7:103773942-103773964 CTTATTTAGCACTGTGAGCTAGG + Intronic
1031804148 7:126288247-126288269 CATATTGAGAACTGATAGCATGG - Intergenic
1033004299 7:137544735-137544757 CATATTAAAATCTGTGAACATGG + Intronic
1033102649 7:138488499-138488521 CATTTAAAGCAGTGTGAGGAGGG - Intronic
1033240493 7:139675370-139675392 CATATGAAAAACAGTGAGCAAGG + Intronic
1033902518 7:146160182-146160204 CATTTAAAGCAGTGTGTGCAGGG + Intronic
1034314285 7:150115720-150115742 CTCAGTCAGCACTGTGAGCAGGG + Intergenic
1034521617 7:151625055-151625077 CATTGTAAGCTCTGTGAGGATGG - Intronic
1035667655 8:1390924-1390946 CAAATTAAACACAGTCAGCATGG + Intergenic
1042359537 8:67867105-67867127 ATTATTAAACACTGTAAGCAAGG + Intergenic
1044142413 8:88672068-88672090 CACTTTAATCACTGTGATCATGG - Intergenic
1046298426 8:112253787-112253809 CATTTTAAACACTGACAGCAAGG + Intronic
1046358524 8:113119020-113119042 CATAAGAAGCCCTGTGAGAAAGG + Intronic
1049737997 8:144220252-144220274 CGGATTAAGCACTGGGGGCAGGG - Intronic
1050113131 9:2237114-2237136 AAAATTAAGCACTGTGGCCATGG - Intergenic
1051764884 9:20512990-20513012 CATATTAAGAACTGTAAGTGAGG + Intronic
1052796626 9:32929069-32929091 CCTCTTAAGGGCTGTGAGCAGGG + Intergenic
1058109401 9:101015853-101015875 CATCTGAAGCACTGTTAGCAAGG + Intergenic
1058919960 9:109603924-109603946 CATATTAAGCCACATGAGCATGG - Intergenic
1062018204 9:134302848-134302870 CAGATAAAGCCCTGTAAGCATGG + Intergenic
1187580286 X:20600088-20600110 CATATTAATTAATTTGAGCACGG + Intergenic
1188355918 X:29191403-29191425 CACATTAATCACTGAGAGGAGGG - Intronic
1189557736 X:42163029-42163051 GAGATTAATCACTGTGATCATGG - Intergenic
1195003997 X:100669146-100669168 CATATGAAGCAGTGTGGGAAAGG - Intronic
1197408181 X:126081576-126081598 AATATTAAGCTTTGTGAGGAAGG + Intergenic
1197769010 X:130077785-130077807 CACATAAAGCACTCAGAGCAGGG + Intronic
1198564810 X:137893607-137893629 CATATTACCCCCTGTGAGGAAGG + Intergenic
1198647288 X:138823197-138823219 TATATTAAACACTGTGAAAAAGG + Intronic
1199711744 X:150474420-150474442 CATCTAAAGCACTTTGAACAGGG + Intronic
1202328663 Y:23721413-23721435 CACTTTAATCACTGTGATCATGG + Intergenic
1202542108 Y:25948641-25948663 CACTTTAATCACTGTGATCATGG - Intergenic