ID: 1083205892

View in Genome Browser
Species Human (GRCh38)
Location 11:61148950-61148972
Sequence GAGATTCCTCCCACCCACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083205881_1083205892 19 Left 1083205881 11:61148908-61148930 CCTTTCTAAGGAATTGCTGGGGT 0: 1
1: 0
2: 1
3: 11
4: 117
Right 1083205892 11:61148950-61148972 GAGATTCCTCCCACCCACCAGGG 0: 1
1: 0
2: 1
3: 15
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083205892 Original CRISPR GAGATTCCTCCCACCCACCA GGG Intronic
901161075 1:7177124-7177146 GAGGCTCCTCCCACACACCGAGG + Intronic
902821904 1:18948588-18948610 GAGTGTCCTCCCACCCACACTGG - Intronic
903787044 1:25868239-25868261 CAGAGTCCTCCCACCCAGCAAGG + Intronic
905292719 1:36933829-36933851 GAGGTTCCTGCCACACACCCAGG - Intronic
908691791 1:66788701-66788723 GGTTTTCCACCCACCCACCAGGG + Intergenic
908964310 1:69739410-69739432 GAAATTCTTTCTACCCACCAAGG + Intronic
909567246 1:77066952-77066974 TATATTCCTCCCACCTACCATGG - Intergenic
912739827 1:112183802-112183824 TAAATTCCTCCCACCCATCAAGG + Intergenic
913034757 1:114953093-114953115 GGGATTCCTGCCACCCATAAGGG + Intronic
916912690 1:169367853-169367875 GAGATTACTCCCAGCCACTAAGG - Exonic
921009040 1:211123008-211123030 GAGATTCCTCCCATTCACTCTGG - Intronic
922565579 1:226599391-226599413 GGGATTACTCCCAGCAACCATGG + Intronic
922625079 1:227032305-227032327 TATTTTCCTCCCAGCCACCAAGG - Intronic
1062826788 10:575785-575807 CAGTTTCCTCCCACCCAACTAGG + Intronic
1063386727 10:5620556-5620578 GAGCGTCATCCCACCCACCCCGG + Intergenic
1069993475 10:72328927-72328949 GAGGTTCCTCTCACCCCTCAGGG - Intergenic
1070253915 10:74797758-74797780 GAGAGTCATCCCACTCATCATGG - Intergenic
1073452298 10:103617150-103617172 GAGATGCCTCTCGCCCACCTGGG - Intronic
1074940816 10:118234612-118234634 TGGAGTCCTCCCACCCCCCAAGG - Intergenic
1075676556 10:124299949-124299971 CAGCCTCCTGCCACCCACCAAGG + Intergenic
1076814032 10:132905831-132905853 GAGATGCCTGCCACCCACCCTGG - Intronic
1076987182 11:246575-246597 GAGATTCTGCCCACACACAAGGG - Intronic
1079466744 11:20738219-20738241 GAAAATCCCCCCACCCACCAGGG - Intronic
1079559138 11:21800935-21800957 GAGACTCCTCTCACTCAGCAGGG - Intergenic
1081195839 11:40159524-40159546 GAGATTCTTCCCACTTACTAAGG + Intronic
1083019135 11:59488553-59488575 GACATTGCCCCCACCCACCATGG + Intergenic
1083205892 11:61148950-61148972 GAGATTCCTCCCACCCACCAGGG + Intronic
1083642421 11:64152757-64152779 GAGCTTCCTCCCACACACTAAGG + Intronic
1085313706 11:75531019-75531041 GGGATGCCTCCCACCCACTTGGG - Intergenic
1085374533 11:76047242-76047264 CAGATTGCTCCCACCCTTCAGGG - Intronic
1088968496 11:114750017-114750039 GACATTCTTCTCACCCACCCAGG + Intergenic
1089171341 11:116513744-116513766 AAGAATCCTCTCACCCACCCGGG + Intergenic
1089502423 11:118940381-118940403 GAGCTTCCCCCCACCCCCCGGGG - Intronic
1090004588 11:122990344-122990366 GAGATTCCTCACTCCTACCCAGG - Intergenic
1090713484 11:129409425-129409447 CACATTCCCCCCACCCTCCAGGG + Intronic
1090873606 11:130769496-130769518 GAGCTTCCTCCCACACATGATGG - Intergenic
1091278242 11:134366848-134366870 CAGATCCCTCCCCCCCACCCTGG - Intronic
1096612055 12:52808668-52808690 GAGATCCATACCACCCACCTTGG + Exonic
1099439822 12:82686774-82686796 GAGGCTCCTCCCACCCTCCCCGG - Intergenic
1100029950 12:90174411-90174433 GAGTTACCTACCACCCACCGGGG + Intergenic
1101820595 12:108181236-108181258 GACCTTCCTCCCTCCCACCCCGG + Intronic
1101925303 12:108966629-108966651 GAGCTTCCTCCTCCCCAGCATGG - Intronic
1104967815 12:132517197-132517219 GAGCTTCCTCCCACCTGACAGGG + Intronic
1107765511 13:43730093-43730115 GAGATTGCTCCTATCCCCCATGG - Intronic
1112323850 13:98430417-98430439 GGGAGTCCTCCCTCCCACCCAGG + Intronic
1112437316 13:99399651-99399673 TAGATTCCAGCCTCCCACCAAGG + Intergenic
1119371130 14:74144301-74144323 GAGACCCCTCCCAACCCCCATGG - Intronic
1120162091 14:81156727-81156749 GAAATCCCTCACACCCATCAGGG + Intergenic
1120203959 14:81567773-81567795 CAGATGCCTCACACCCACCTGGG + Intergenic
1120414161 14:84198335-84198357 GAGATTCCCCCCACAAACAATGG + Intergenic
1121493577 14:94377323-94377345 GAGAGTCCTTCCATCCTCCAAGG - Exonic
1122334683 14:100963695-100963717 GAGAATCTTCCCACGGACCAGGG - Intergenic
1122942055 14:104985874-104985896 GAGAGTCCCCGCACCCACCTTGG - Exonic
1129174876 15:73832702-73832724 CAGCTTCCTCCCACAGACCAGGG + Intergenic
1129272031 15:74424080-74424102 GAGCATCCTCCCACCCACCAAGG + Intronic
1130325681 15:82877907-82877929 CAGAATCCCCCCACCCTCCAAGG - Intronic
1131693842 15:94855199-94855221 GAGATACCTCTTTCCCACCATGG + Intergenic
1131973325 15:97914824-97914846 GAGATTTCTCCCAGCCAAGAAGG + Intergenic
1132567598 16:630558-630580 GAGGTTCCTTCCCCCCTCCATGG - Intronic
1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG + Intergenic
1132999835 16:2843677-2843699 TAGCTTCCTCGCAACCACCAAGG + Intergenic
1134568899 16:15274731-15274753 GGGATTCCTTCCACCAAGCAAGG - Intergenic
1134733535 16:16481631-16481653 GGGATTCCTTCCACCAAGCAAGG + Intergenic
1134933965 16:18230651-18230673 GGGATTCCTTCCACCAAGCAAGG - Intergenic
1136448040 16:30335867-30335889 GAGCTTCTGTCCACCCACCAGGG - Intergenic
1136990410 16:35148243-35148265 CAGAGATCTCCCACCCACCATGG - Intergenic
1140836433 16:78798555-78798577 TATATTCCTCCCTCCCCCCAAGG + Intronic
1140855689 16:78975802-78975824 CTGTTTCCTCCCACCCTCCAAGG - Intronic
1142047829 16:87936961-87936983 GAGCTTCTGTCCACCCACCAGGG + Intergenic
1142066389 16:88065364-88065386 GAGACTCCTCCCAGCCACAGAGG - Intronic
1144706435 17:17371405-17371427 GAGATTCCTCAGACACACAAAGG - Intergenic
1146658641 17:34650052-34650074 GAGCTGCCTCCCAGCCTCCATGG - Intergenic
1146918893 17:36696639-36696661 GACATTGCTCCCACCCCCCTGGG + Intergenic
1147922248 17:43925058-43925080 GAAATTTCTGCCACCCAGCATGG - Intergenic
1150073047 17:62168860-62168882 CACAGTCCTCTCACCCACCATGG + Intergenic
1150608971 17:66717934-66717956 GTGATTCCTCCCACACAACTGGG - Intronic
1151397825 17:73836121-73836143 GAGATTCCCTGGACCCACCACGG - Intergenic
1151491396 17:74433823-74433845 GAGACCCCCTCCACCCACCAGGG - Intronic
1153835700 18:8962250-8962272 CAGATTCCCCGCACCCACCAAGG - Intergenic
1155429878 18:25743997-25744019 GGGATTCCTCCGAGCCAGCAGGG - Intergenic
1155888046 18:31232395-31232417 GAGATGCTCCCCACACACCATGG + Intergenic
1156438031 18:37154670-37154692 GAGCTTGCTATCACCCACCATGG + Intronic
1156862446 18:41853994-41854016 CAGCTTCCTCCCATCTACCAGGG + Intergenic
1157428814 18:47606421-47606443 GAGATTACTCCCAGCCAGGATGG - Intergenic
1158864585 18:61625883-61625905 AAGCTTCATCCCAACCACCAGGG + Intergenic
1160319451 18:77876592-77876614 GAGCTTCCTCCCACCAGACAAGG - Intergenic
1160465804 18:79074672-79074694 GAGACTCCCCTCTCCCACCAAGG - Intronic
1160530385 18:79558983-79559005 GAGATCCCTGCCAGCCTCCAAGG + Intergenic
1161542603 19:4861145-4861167 GAGATTCCCCCCTCCCAACTGGG + Intronic
1161589164 19:5121053-5121075 GAGGTCCCTCCCACCTGCCAGGG + Intronic
1165435514 19:35792747-35792769 GTGACTCCTCCCATCCCCCAGGG - Intergenic
926162849 2:10500862-10500884 GAGACTCTTCCCTCCCTCCAGGG + Intergenic
927869092 2:26612539-26612561 GAGAGGCCTCCGAGCCACCAGGG - Intronic
928409122 2:31040710-31040732 GAGAGTCCTCCCATTCACCTAGG - Intronic
929536420 2:42787087-42787109 CAGATTCCTCCCAGACACCTGGG + Intronic
930151114 2:48061049-48061071 GAGATTTCTCCTCCCCACAAAGG - Intergenic
934627955 2:95879226-95879248 GAAATTTCTCACACCCACAAAGG - Intronic
935656626 2:105428851-105428873 GACATGCCTCCCATCCAACAGGG - Intronic
935732770 2:106078255-106078277 GAGATTCCTCACCACCACCCAGG + Intergenic
936082134 2:109439501-109439523 GAAATGCCTCCCACCCATCGGGG - Intronic
942026184 2:171912952-171912974 TGGCTTCCCCCCACCCACCAAGG - Intronic
942542019 2:177024430-177024452 GAGATTCCTCCCCCCACCCCAGG + Intergenic
948588384 2:239035260-239035282 GAGACTCCCCCCACCCCCCTGGG - Intergenic
948921303 2:241067155-241067177 GCGGTCCCTTCCACCCACCATGG - Intronic
1173518055 20:43679010-43679032 TACATTCTTCCCACCCACCCTGG - Intronic
1174143385 20:48432839-48432861 AAAATTCCTCCTACCCTCCAAGG - Intergenic
1174277290 20:49413276-49413298 AATCTTCCTCCCACCCAGCAAGG - Intronic
1175704089 20:61162963-61162985 GGGTCTCCTCCCACCCACGATGG - Intergenic
1175789265 20:61731394-61731416 GAGATCCCTGCCACCCCACAGGG + Intronic
1176796066 21:13371958-13371980 CAGAGCCCTCGCACCCACCATGG - Intergenic
1178352534 21:31882799-31882821 TCCATCCCTCCCACCCACCAGGG + Intronic
1180079102 21:45478162-45478184 GAGCCTCCTCACACCCACAAGGG - Intronic
1180693266 22:17735828-17735850 GTGATTCCTCTGACCCAGCAGGG - Intronic
1181089669 22:20464035-20464057 GAGATTTCTCACATGCACCAAGG + Intronic
1182582206 22:31321006-31321028 GAGATGCCTCCCACCCTTTATGG + Intergenic
1183731886 22:39622775-39622797 GAGGTCCCTCCCGCCCACCCAGG - Intronic
1184672125 22:46019455-46019477 GAGATTCCTCCCCCACCACATGG - Intergenic
1184739535 22:46419403-46419425 GAGATGCCTCCCACCCATAGAGG - Intronic
1185060578 22:48604444-48604466 GAGATGGCTCCCGCCCAGCAGGG + Intronic
1185085581 22:48739123-48739145 GAGAACCCTCCCCCGCACCAGGG + Intronic
950116151 3:10451268-10451290 CACAGTCCACCCACCCACCAGGG - Intronic
950528413 3:13538455-13538477 GAGATTCCTCCCACCTGCTCAGG + Intergenic
950943876 3:16924238-16924260 GAGATTTCCCCCACTCCCCAGGG + Intronic
951023578 3:17806482-17806504 GAGATTTCTGGAACCCACCATGG - Intronic
955112912 3:55966810-55966832 TACATGACTCCCACCCACCATGG + Intronic
955925362 3:63999001-63999023 GAGTTTCCTCCTCCCCAGCATGG + Intronic
956808126 3:72837178-72837200 GAAATTGCTGCCAGCCACCAGGG - Intronic
960952452 3:123008497-123008519 CAGATCCCACCCACCCATCAGGG - Intronic
961210420 3:125120884-125120906 GAGCCTCCTCCAACCCACAAAGG - Intronic
963021081 3:140873669-140873691 GAGATTCCTCCCCTCCCTCAGGG + Intergenic
964977788 3:162640343-162640365 GAGTCTCCTCCCCCCCACCGTGG + Intergenic
970432266 4:16000117-16000139 CAGGTTCCTCCCACACACCCTGG - Intronic
976152329 4:82104804-82104826 CAGATCCCCTCCACCCACCAGGG - Intergenic
976765128 4:88591691-88591713 GAGCTTCCTCCCCCTCCCCAAGG - Intronic
978555202 4:109972515-109972537 GAATTTCTTCCCTCCCACCAAGG + Intronic
978684570 4:111423982-111424004 GATCTTCTTCCCACCCTCCAGGG - Intergenic
982441739 4:155443661-155443683 GAGGGTCCTGCCACACACCAAGG - Intergenic
982976961 4:162075888-162075910 GAGATTCCAGCCACCCACACAGG - Intronic
994310006 5:98258910-98258932 GAGATTCCCCAGACCCACCACGG - Intergenic
996208984 5:120781521-120781543 GAGATGCCTCCCATACACCAAGG - Intergenic
998545337 5:143022901-143022923 GAAATTCCTTCCAGCCCCCATGG - Intronic
999552336 5:152702992-152703014 GAGGTTCCTGCCACCTTCCAGGG - Intergenic
1000238655 5:159387891-159387913 GAGAATCCTCCAACCCATCAGGG - Intergenic
1001526654 5:172433827-172433849 GAGATTCCAACCAACCAACATGG - Intronic
1001939812 5:175732549-175732571 GAGAACCCTCCCACCACCCACGG - Intergenic
1005198799 6:23319524-23319546 GTGATGCCTGTCACCCACCAGGG + Intergenic
1007366529 6:41398030-41398052 GAGAGTCCCTGCACCCACCATGG + Intergenic
1007909072 6:45495035-45495057 AAGATTCCACCCATCCTCCAAGG + Intronic
1007950556 6:45868501-45868523 AGAATTCCCCCCACCCACCATGG - Intergenic
1008059375 6:46981146-46981168 GAGATTTCTCCCACACCCCTGGG - Intergenic
1010579394 6:77575393-77575415 GTGATTCCCCCCACCCACCTCGG + Intergenic
1011155845 6:84330456-84330478 GAGATGCCTGGCACCCAGCAAGG + Intergenic
1011959692 6:93072112-93072134 GTGTTTCCTCCCAACCAACAAGG + Intergenic
1012352718 6:98272611-98272633 CATATTCCTACCACACACCATGG + Intergenic
1016913337 6:149221157-149221179 AGTCTTCCTCCCACCCACCATGG + Intronic
1017355638 6:153503995-153504017 CAGATTCCTCCCACAGACCTTGG + Intergenic
1017725518 6:157273967-157273989 GGGATCCCTCCCATCCACCTCGG - Intergenic
1018324229 6:162647716-162647738 GTAATTCCTGCCACTCACCAAGG + Intronic
1018800595 6:167219259-167219281 GTGAATCCTCCCAGCCTCCATGG + Intergenic
1022033003 7:26508982-26509004 GAGATTCTGCCCACCCCCAAGGG + Intergenic
1022414815 7:30168760-30168782 AAGATGCTTCCTACCCACCAGGG - Intergenic
1023027631 7:36065162-36065184 GAAGTTCCTCCCCCCCATCAGGG - Intergenic
1023123053 7:36928725-36928747 GTCAGTCATCCCACCCACCAGGG + Intronic
1023941025 7:44768416-44768438 GAGAGCCCACCCACCCACCTCGG - Exonic
1025200583 7:56958955-56958977 GAGATTACTCCTCCCCACCTGGG + Intergenic
1025671361 7:63617977-63617999 GAGATTACTCCTCCCCACCTGGG - Intergenic
1029679329 7:102097197-102097219 GAGAATTCTCCCACCCAGCAAGG + Intronic
1033673604 7:143516273-143516295 GAGTATTCTCCCTCCCACCATGG + Intergenic
1034470953 7:151254102-151254124 GAGATGGCTCCCACACACCTGGG - Intronic
1036816076 8:11903692-11903714 GAGATGCCTTCCAGGCACCACGG - Intergenic
1037451030 8:19015087-19015109 AAGGTTCCTCCCACACACCTGGG - Intronic
1037814648 8:22105597-22105619 AGGATTCCTACCACCCTCCAGGG + Intergenic
1039202255 8:35108859-35108881 GAAATTCCTCAGACCTACCATGG - Intergenic
1041457976 8:58080772-58080794 GAAATTCCTCCTATTCACCAGGG + Intronic
1043678273 8:82988977-82988999 TAGGTTCCTCCCACCAAACATGG - Intergenic
1044245329 8:89937667-89937689 GTGACTTCTCCCACCTACCAAGG + Intronic
1045497357 8:102719703-102719725 GTGAATCCTCCCACTCACCCAGG - Intergenic
1046352995 8:113040865-113040887 TGGATTCCCCCCACACACCAAGG + Intronic
1047666883 8:127101342-127101364 TAGATTTCTCCATCCCACCAAGG - Intergenic
1048004898 8:130411292-130411314 GAGCTTGCTCTCAGCCACCAAGG + Intronic
1048672401 8:136737367-136737389 GAGATTCCCCCCACCCCCACAGG - Intergenic
1048877807 8:138850708-138850730 GAGCTTCCTCCCATCAACCTTGG - Intronic
1051368704 9:16339936-16339958 TCAATTCCTCCCACCCACCCAGG + Intergenic
1051582032 9:18687389-18687411 GTCATTCCTTCCCCCCACCAAGG + Intronic
1055407740 9:75992263-75992285 GAGAAGCCTCCCACCAACAAGGG - Intronic
1058429605 9:104906547-104906569 CCAATTCCTCCCACCCACCTTGG + Intronic
1058956546 9:109954003-109954025 GAGATGCCTCCCAGCCTCCAGGG - Intronic
1060007794 9:120015679-120015701 CACCTGCCTCCCACCCACCAGGG + Intergenic
1060229729 9:121817880-121817902 TAGATCCATCCAACCCACCAAGG - Intergenic
1061283613 9:129610498-129610520 GCGTTTCCCCCCACCCGCCAGGG + Intronic
1061741590 9:132710506-132710528 CAGAGTCCCCCCACCCACCCAGG - Intergenic
1062224065 9:135439087-135439109 GGGATTCCCCAAACCCACCAAGG + Intergenic
1062288075 9:135782303-135782325 GAGACTCCTCTCACACACCGGGG - Intronic
1186740971 X:12517780-12517802 GGGATTCCTCCGAGCCAGCAGGG + Intronic
1192214415 X:69148540-69148562 GAGATTCCTTCCACCCCTCCTGG - Intergenic
1195900036 X:109788115-109788137 GACTTTCCTCTCCCCCACCATGG + Intergenic
1196892128 X:120301569-120301591 TAGACTCCCCCCACCCCCCACGG + Intronic
1199277080 X:145957893-145957915 ACCCTTCCTCCCACCCACCATGG - Intergenic
1199637813 X:149830057-149830079 GAGGTTCAACCCCCCCACCATGG - Intergenic
1199637825 X:149830099-149830121 GAGGTTCAACCCCCCCACCATGG - Intergenic
1200734776 Y:6782549-6782571 GAGGTTCAACCCTCCCACCAGGG - Intergenic
1201744181 Y:17352591-17352613 GAGATTCCTTCCATCCCTCAGGG - Intergenic