ID: 1083207345

View in Genome Browser
Species Human (GRCh38)
Location 11:61160796-61160818
Sequence CTTTGCGCCCAGAGGGTCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083207339_1083207345 11 Left 1083207339 11:61160762-61160784 CCAGGCATATAATGGGTATGTAT 0: 1
1: 0
2: 0
3: 25
4: 204
Right 1083207345 11:61160796-61160818 CTTTGCGCCCAGAGGGTCCCGGG 0: 1
1: 0
2: 0
3: 13
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083207345 Original CRISPR CTTTGCGCCCAGAGGGTCCC GGG Intronic
901650794 1:10742054-10742076 CTTTGCAACCACAGGGTCCACGG + Intronic
902715368 1:18269137-18269159 CTTTGCAAACAGAGGGTCACTGG + Intronic
904620234 1:31770819-31770841 CTCTGACCTCAGAGGGTCCCAGG + Intergenic
906127610 1:43437190-43437212 CTGTGCGCCCCGTGGGTACCTGG + Exonic
910984330 1:92990988-92991010 CATTGGTCCCAGATGGTCCCTGG - Intergenic
911686920 1:100788050-100788072 CTTTGGGGCCATAGGGTCACTGG - Intergenic
914808364 1:151008381-151008403 CTCTACGCCCAGAGGCTCCTGGG - Intergenic
919923731 1:202181558-202181580 CCCTTCACCCAGAGGGTCCCAGG + Intergenic
921177374 1:212607067-212607089 CTTTGCGCCCCGGCGGACCCGGG - Intronic
1063167418 10:3476391-3476413 CTTCGCGCCCACAGCATCCCAGG - Intergenic
1063450306 10:6145923-6145945 CTTTGAGCTGAGAGGGGCCCAGG - Intronic
1068690090 10:59906001-59906023 GTGTGCTCTCAGAGGGTCCCCGG + Intronic
1069336606 10:67358798-67358820 CTTAGCCCCAAGGGGGTCCCTGG - Intronic
1074307955 10:112296488-112296510 CTTTGCAGCCAGAGTGCCCCAGG - Intronic
1075407769 10:122206037-122206059 CTTGGCGCCCAGAGGGCCAGAGG - Intronic
1077295566 11:1824887-1824909 CTTTGGGGACGGAGGGTCCCAGG + Intergenic
1081642277 11:44764468-44764490 CTTTGGGCCCAGAGGTGCCAAGG - Exonic
1083207345 11:61160796-61160818 CTTTGCGCCCAGAGGGTCCCGGG + Intronic
1083899425 11:65636526-65636548 CTATCCCCACAGAGGGTCCCCGG + Exonic
1084857899 11:72000585-72000607 CTATGGGCACAGAGGTTCCCAGG + Intronic
1086169897 11:83824284-83824306 CTTTACGCCCATGTGGTCCCTGG + Intronic
1088914918 11:114220179-114220201 CTCTGGGCCCAGATGGTCCTTGG + Intronic
1091348644 11:134874632-134874654 CTGTACGCCAAGTGGGTCCCAGG + Intergenic
1091677916 12:2504718-2504740 ATTTGCACCTAGAGGGTCCCCGG + Intronic
1102428451 12:112862882-112862904 CACAGCGCCCAGAGGGCCCCTGG - Intronic
1103629741 12:122250374-122250396 CGTTGAGACCAGAGGCTCCCAGG - Intronic
1104730392 12:131102522-131102544 CTGTTCGCCCACAGCGTCCCAGG + Intronic
1104963769 12:132500057-132500079 GATTCCGGCCAGAGGGTCCCGGG - Intronic
1105397903 13:20057754-20057776 CATTGCGACCAGAGGCTCACAGG + Intronic
1105656887 13:22451462-22451484 CTTTGTGCCCTGAGGCTCCCTGG - Intergenic
1113962132 13:114132178-114132200 CTCTGCGCCCGGAGCGGCCCCGG - Intronic
1115754092 14:36516715-36516737 CTAGGCGGCCAGAGGGTGCCGGG + Exonic
1117908398 14:60613490-60613512 CTGTGGGCCCAGAGGGTCCAGGG + Intergenic
1119886953 14:78151426-78151448 CTTTGTGAGCAGAGGGTCACTGG + Intergenic
1121053726 14:90836548-90836570 CTTGGCTCCCAGAGGCACCCTGG + Intergenic
1122043447 14:99007071-99007093 CTCGGGGCCCAGAGGGTTCCCGG + Intergenic
1122812412 14:104295608-104295630 CTCTGCGCCCAGCAGCTCCCTGG + Intergenic
1123032277 14:105457539-105457561 CTGTGCCCCCAGAAGGTCCCTGG + Intronic
1123725835 15:23100749-23100771 CTTTGCTCACAGAGGATCACAGG - Intergenic
1128310645 15:66630034-66630056 CTGTGCCCCCTGAGGGTCCTGGG + Intronic
1129341580 15:74889994-74890016 CTCTGCGCCCAGAGCTTCACGGG - Exonic
1130153878 15:81333079-81333101 CTTTGCTGGCACAGGGTCCCAGG - Exonic
1131027672 15:89158489-89158511 CCTTGCTCCCAGAGAGTACCTGG + Intronic
1131060213 15:89399904-89399926 TTCTGCGCCCAGAGGGAGCCAGG - Intergenic
1132694185 16:1194745-1194767 CTCTGCTCCGTGAGGGTCCCAGG - Intronic
1133015250 16:2936747-2936769 CTTTGTCCCCAGAGGGCCCCGGG + Intronic
1136254732 16:29030353-29030375 CTTTGCCCCCAGAGTGGCCCTGG - Intergenic
1136513486 16:30753681-30753703 CTTTGCGCCCACAGGATACTTGG - Intronic
1138180806 16:54938994-54939016 CCTGGCGCACAGAAGGTCCCGGG - Intergenic
1140947548 16:79784061-79784083 CTTTGGACCCAGAGGGACCAGGG - Intergenic
1141113496 16:81289177-81289199 CAATGCCTCCAGAGGGTCCCAGG - Intronic
1141730323 16:85818292-85818314 CTCTGCGCCTAAGGGGTCCCTGG + Intergenic
1142173488 16:88634647-88634669 CTCTGCGCCCACAGGACCCCGGG + Intergenic
1144046033 17:11455624-11455646 CTTTGCTCCCAGAAGAGCCCAGG + Intronic
1144758606 17:17694725-17694747 CTCAGCGCCCCGAAGGTCCCGGG - Intronic
1145957008 17:28861608-28861630 CTGTGCCCCCAGTGGGGCCCTGG - Intergenic
1146850775 17:36219823-36219845 CAGTGGGCCCAGTGGGTCCCTGG + Intronic
1146896323 17:36544780-36544802 ATTTGCGCCCAGAGGGTGCGGGG - Intergenic
1151721057 17:75856074-75856096 CTTAGCGCCCAGCGGGGTCCCGG + Intronic
1152337977 17:79708635-79708657 CTGTGCGCCCTGCGGGGCCCAGG + Intergenic
1153131440 18:1858930-1858952 CAGTGCGTCCAGTGGGTCCCTGG - Intergenic
1153484872 18:5586872-5586894 ATTTGAGCCCTAAGGGTCCCAGG + Intronic
1156517960 18:37697127-37697149 CTCTGCCCTCAGAGGGTCCTGGG + Intergenic
1156836591 18:41562298-41562320 GTTTTTGCCCAGTGGGTCCCTGG - Intergenic
1159632351 18:70763656-70763678 CTTTGCTGGCAGAAGGTCCCAGG + Intergenic
1160802388 19:976435-976457 CTGTGCCCCCAGGGGGACCCTGG + Intergenic
1161163306 19:2772480-2772502 GGCTGCGCGCAGAGGGTCCCTGG - Intronic
1161769423 19:6223266-6223288 CTGAGCGCCCACTGGGTCCCTGG + Intronic
1162330714 19:10027624-10027646 CTTTGAGCTCAGAGCTTCCCAGG - Intergenic
1165810635 19:38609753-38609775 CTGTGTGCCCAGAGGGTTACAGG - Intronic
924978880 2:202251-202273 CTTGGCATCCAGAGGGGCCCAGG - Intergenic
926146827 2:10401419-10401441 CTAGGCCCCCAGAGGGTCTCCGG + Intronic
927351829 2:22125160-22125182 CTTGGGGGCCAAAGGGTCCCTGG + Intergenic
929889253 2:45905875-45905897 CTTTACTCCAAGAGGTTCCCTGG + Intronic
934604491 2:95683420-95683442 TTCTGTGCCCTGAGGGTCCCAGG - Intergenic
937435937 2:121881338-121881360 ATGTGTGCCCAGAGGGTGCCAGG + Intergenic
937852725 2:126649935-126649957 CGGTGGGCCCAGTGGGTCCCCGG - Intergenic
946173812 2:217910628-217910650 CTTTGGTTCCAGAGGGTCCCGGG - Intronic
948596240 2:239081522-239081544 CTTTCTGCCCAGAGAGACCCAGG - Intronic
1171896771 20:30815599-30815621 CTTGGCGCCGAGAGTGTCCATGG + Intergenic
1172447760 20:35002063-35002085 CTTGGGGCCCAGGGCGTCCCGGG - Exonic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1177916299 21:27092089-27092111 TTTAGCGGCCAGAGGGTACCAGG - Intergenic
1179716615 21:43291792-43291814 CTGTGCCCCCGGAGGGTCACTGG - Intergenic
1179838732 21:44056101-44056123 TTTTGCCCCCAGAGGCTCCCCGG - Intronic
1180074081 21:45453898-45453920 CTCTGTGCTCAGAGGGTCACTGG - Intronic
1180949671 22:19715355-19715377 ATTTGTACCCACAGGGTCCCAGG - Intronic
1185273877 22:49941604-49941626 CTTTGCGCAGAGCGGCTCCCAGG + Intergenic
1185416444 22:50712893-50712915 CTGTGCACCCAGAGGGCCCTGGG + Intergenic
954053961 3:48006458-48006480 CAGTGGGCCCAGTGGGTCCCTGG + Intronic
959378477 3:105613488-105613510 CTTTGAGCCCAGTGGGTGCCAGG + Intergenic
960669361 3:120141409-120141431 CATTCCGCCCAGTGGGTTCCTGG - Intergenic
961738983 3:129020765-129020787 CTGTGAGCCCAGAGGCTCCAGGG + Intronic
962838103 3:139206430-139206452 CTTTTCTCCCAGAAAGTCCCTGG - Intronic
968701953 4:2061548-2061570 CTGTGCCCCAATAGGGTCCCCGG - Intronic
970089341 4:12387558-12387580 CAGTGGGCCCAGTGGGTCCCTGG - Intergenic
972335778 4:38106359-38106381 TCCTGCGCTCAGAGGGTCCCAGG - Intronic
972458642 4:39278680-39278702 CCTTGCGCCCAGAAGGTGCGTGG - Intronic
982138799 4:152297708-152297730 CTCAGCTCACAGAGGGTCCCTGG + Intergenic
984952291 4:185016745-185016767 CTCTGCGCCCTGAGGCTCCCAGG + Intergenic
985575394 5:671325-671347 CTTGGGGCCCAGAGGGACCCCGG + Intronic
986261749 5:6153442-6153464 CAGTGGGTCCAGAGGGTCCCTGG - Intergenic
987420993 5:17719670-17719692 CTTTGGGCCCAGGGAGTCACTGG + Intergenic
987578501 5:19759529-19759551 CAGTGGGCCCAGTGGGTCCCTGG - Intronic
994549431 5:101211508-101211530 CTTTGCTCTCAGAGAGTTCCAGG - Intergenic
997469468 5:134108817-134108839 CTTTGACCCCATAGGGTCCCTGG - Intergenic
998769129 5:145521745-145521767 CTTTGAGCCAAGAGGATACCTGG - Intronic
999119947 5:149201479-149201501 CTTAGCTCCCAGGGGCTCCCCGG + Intronic
999707294 5:154285222-154285244 CTTTGCCCTCACAGTGTCCCTGG - Intronic
1003300332 6:4874935-4874957 CTTTGCTCTCAGTGGGTACCTGG + Intronic
1007500105 6:42290263-42290285 CTTAGCACCCAGTGGGTGCCAGG - Intronic
1019197625 6:170291395-170291417 CCTTGCGCCGACAGCGTCCCGGG + Intergenic
1021969241 7:25950975-25950997 CGGGGCGCCCAGAGGCTCCCGGG + Intergenic
1027298988 7:76809992-76810014 CATTGCCTCCAGAGGGTGCCTGG + Intergenic
1030096666 7:105906657-105906679 CCAAGCCCCCAGAGGGTCCCAGG - Intronic
1030616289 7:111741557-111741579 CTGTGAGCCCAGATGGTACCAGG - Exonic
1031676397 7:124617116-124617138 CAGTGGGTCCAGAGGGTCCCTGG + Intergenic
1041195977 8:55401668-55401690 CTTTGGCCCCAGATGGACCCAGG - Intronic
1042425251 8:68640413-68640435 ATTTGCTCCCAGAAGGTACCAGG - Exonic
1043872244 8:85446469-85446491 CTTGGCCCCCAAAGGGTACCAGG + Intronic
1046175416 8:110569849-110569871 CTTGGCACCCAGTGAGTCCCAGG - Intergenic
1047975022 8:130121435-130121457 CTTTGCCCCCAGAGGATACTTGG - Intronic
1049448134 8:142641087-142641109 CTTGGAGCCCACAGAGTCCCTGG + Intergenic
1049618125 8:143585219-143585241 CTTTGGGCCCCCAGGATCCCAGG - Intronic
1056314404 9:85374163-85374185 CAGTGCGTCCAGTGGGTCCCCGG - Intergenic
1057177012 9:93007790-93007812 CTTTGCCCCCCGGGGATCCCAGG + Intronic
1057183037 9:93040075-93040097 CTTTGGGCCCAGCCGGTGCCTGG + Intergenic
1059176776 9:112175273-112175295 CTCTGCACCCTGAGGGCCCCGGG - Intronic
1061055663 9:128221539-128221561 CTTTAAACCCAGAGGGTCCAAGG + Intronic
1061403556 9:130381687-130381709 TTTTGATCACAGAGGGTCCCAGG + Intronic
1062630109 9:137459548-137459570 CTTTGCGACCAGGGGGCCGCTGG - Intergenic
1195230128 X:102838654-102838676 CTTTGTGCCCTGAGGCTGCCAGG - Intergenic
1195710603 X:107770651-107770673 CTTTGACCCCAGAGCGTACCTGG - Intronic