ID: 1083207526

View in Genome Browser
Species Human (GRCh38)
Location 11:61161500-61161522
Sequence CACGCGCGCCACTGGGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 72}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083207526_1083207530 -2 Left 1083207526 11:61161500-61161522 CCGGCGCCCCAGTGGCGCGCGTG 0: 1
1: 0
2: 1
3: 3
4: 72
Right 1083207530 11:61161521-61161543 TGCTCGCCCCGCGACCCCGTTGG 0: 1
1: 0
2: 0
3: 0
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083207526 Original CRISPR CACGCGCGCCACTGGGGCGC CGG (reversed) Exonic
901673278 1:10868108-10868130 CACGCAGGCCCCTGGGGAGCTGG + Intergenic
907442587 1:54488347-54488369 CGCGCGCTCCGCTCGGGCGCTGG - Intergenic
915128077 1:153679470-153679492 GAAGCGCCCCACTGGGGCGGCGG - Exonic
919872003 1:201829101-201829123 CCCGCCCGCCTCTGGTGCGCAGG + Intergenic
1062843853 10:689891-689913 CGCGCGCGTCACGGGGCCGCGGG + Intergenic
1063298041 10:4826245-4826267 CGCGCGAGCTACTGCGGCGCTGG - Exonic
1072283779 10:93894105-93894127 CCCGGGCGCCACTGAGGAGCCGG + Exonic
1075768993 10:124917369-124917391 CGCGGTCGCCCCTGGGGCGCCGG - Intergenic
1077073179 11:687093-687115 CACATGAGCCGCTGGGGCGCTGG - Intronic
1083207526 11:61161500-61161522 CACGCGCGCCACTGGGGCGCCGG - Exonic
1084418533 11:69048870-69048892 CGCGCACGGCACTGTGGCGCAGG - Intergenic
1085485609 11:76860784-76860806 CACCGGCGCCGCTGGGCCGCGGG - Intergenic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1100620870 12:96271455-96271477 CACACGCGCCACTGGGGAGTGGG - Intergenic
1101781895 12:107844758-107844780 GACGCGCGGCACAGGTGCGCAGG + Intergenic
1102519809 12:113471262-113471284 CGCGCGCTCCACTGGGGCGCTGG - Intronic
1104913132 12:132249891-132249913 CACGCGGGGCACAGGGGTGCAGG + Intronic
1105299008 13:19116826-19116848 CACGCTGGCCACTGGGTGGCAGG + Intergenic
1108407936 13:50124072-50124094 CGCCCGCGTCCCTGGGGCGCCGG - Intronic
1121595113 14:95156858-95156880 CACGCGCGCTAAGGTGGCGCGGG - Intronic
1122920910 14:104879752-104879774 CACGCCCCCCACAGGGGCCCCGG - Intronic
1123927843 15:25135690-25135712 CAGGCGTTCCACTGGGGAGCTGG - Intergenic
1128944468 15:71811491-71811513 CACACGCGGCACTGGAGCGAGGG - Exonic
1133275582 16:4636420-4636442 CACGGGCAGCACTGGGACGCTGG - Intronic
1134441749 16:14302780-14302802 CACACGCCCCTCTGGGGAGCGGG - Intergenic
1139779538 16:69339425-69339447 CGCTCGCGCCACTGGGCCTCGGG + Exonic
1143487441 17:7262526-7262548 CCCGCGCGCCCCGGGAGCGCGGG + Intronic
1143656240 17:8295388-8295410 CACTCCTGCCACTGGAGCGCGGG + Intergenic
1144764413 17:17724933-17724955 CGCGCGTGAGACTGGGGCGCAGG - Intronic
1151580065 17:74972571-74972593 CAGGTGCGCCACGGGGGCCCCGG - Exonic
1151805142 17:76400400-76400422 CACGCGTGCCCCTGGGTTGCTGG + Intronic
1152244844 17:79179932-79179954 CAGGAGCCCCACTTGGGCGCCGG - Intronic
1154415815 18:14174708-14174730 CACGCCAGCCACTGGGTGGCAGG + Intergenic
1158150065 18:54357867-54357889 CATGCGCGGCAGTGGGGCGCCGG - Exonic
1162485997 19:10960964-10960986 CGCGCGCGCAGCGGGGGCGCGGG + Intergenic
1165431385 19:35775484-35775506 CGCGCGCCCCACGGGGGCGGGGG - Intronic
1166811178 19:45515454-45515476 CATGGGCACCACTGGGGCCCGGG - Intronic
925068852 2:950852-950874 CTCGGGCTCCACCGGGGCGCAGG - Exonic
925128349 2:1477323-1477345 CACGCGCGCCTCCGGGACTCCGG + Exonic
928437144 2:31261923-31261945 CACCTGCACCACTGGGGCGGTGG - Intronic
937926103 2:127168650-127168672 CACGCCCACCACTGGGTCTCAGG - Intergenic
938312560 2:130302456-130302478 CACGCTGGCCACTGGGTGGCAGG - Intergenic
948621665 2:239239138-239239160 CACACACGCCACAGGGGCTCAGG + Intronic
1174204476 20:48828485-48828507 CACGCGCGCCTCCGCGGCCCCGG + Intergenic
1175117264 20:56691389-56691411 CAGGAGGGCCACTGAGGCGCTGG - Intergenic
1183441337 22:37824779-37824801 CACCAGCCCCACTGCGGCGCGGG - Exonic
953837383 3:46358568-46358590 CACGCCTTCCACTGGGGAGCAGG + Intronic
953839047 3:46373919-46373941 CACCCGATCCACTGGGGAGCAGG + Exonic
954404383 3:50337366-50337388 CACGCACGCGACCGGGGCGGTGG - Intronic
958004319 3:87792882-87792904 CACGCCCGCAGCTGGCGCGCAGG + Intergenic
961365185 3:126395058-126395080 CACGCGCGCCCCTCGGGCCCTGG - Intronic
963289297 3:143471158-143471180 CACGCACGGCACTGCGGCACTGG + Intronic
969691928 4:8708634-8708656 CACTCTCCCCACTGGGGCTCTGG + Intergenic
970617593 4:17781972-17781994 CACTCGCGCAACTCAGGCGCTGG - Intergenic
985493334 5:191687-191709 CGCGCGCGGTGCTGGGGCGCTGG + Exonic
985563076 5:601772-601794 CACGGGCGCCCCTCGGGGGCAGG + Intergenic
986533990 5:8767481-8767503 CACGAGGGCCCCTGGGGCCCAGG - Intergenic
986748039 5:10761179-10761201 GACGCGCGCGCGTGGGGCGCCGG + Exonic
1002895810 6:1379496-1379518 CACGCGCGCCACAGCGTGGCAGG - Intergenic
1005778136 6:29160077-29160099 GTCGCCTGCCACTGGGGCGCGGG + Intergenic
1006136135 6:31897380-31897402 CACGCGTGCTCCTGGGGCCCCGG + Intronic
1011693129 6:89887929-89887951 CAGGCTCTCCACTGGGCCGCGGG - Intergenic
1013117571 6:107114778-107114800 CACGCGCGCCGCGCGGGGGCGGG - Intronic
1019288438 7:235351-235373 CACGGGCTCCACTGGGCTGCAGG - Intronic
1019337992 7:494241-494263 CCCGCCCGCCCCCGGGGCGCCGG + Intergenic
1020796799 7:12686830-12686852 CCCGCGCGCCGCCCGGGCGCCGG - Intergenic
1033474195 7:141674919-141674941 CCTGCGCTCCACTGGGGGGCAGG - Intronic
1035553328 8:545533-545555 CATGCGCGCCGCTGGCGCTCAGG + Intronic
1038319221 8:26513045-26513067 CAGGCGGGGCTCTGGGGCGCAGG + Intronic
1040471297 8:47737786-47737808 CCCGCGCGCCCCTTGGGCCCGGG - Exonic
1046890568 8:119416805-119416827 CGCGCGCACCCCGGGGGCGCAGG - Exonic
1049608456 8:143541032-143541054 CCCGCGCCCCACTGCGGGGCTGG - Intronic
1057379124 9:94553400-94553422 CACGCTGGCCACTGGGCGGCAGG + Intergenic
1057432322 9:95005242-95005264 CGCCGGCGCCACCGGGGCGCAGG - Intronic
1197891860 X:131276946-131276968 CACGAGCTCCACAGGGTCGCTGG + Exonic
1198424183 X:136497883-136497905 CACGGGCGCCACTGCAGAGCGGG + Intronic
1199700156 X:150369779-150369801 CACGTGCACCACTGGGGTGTGGG + Intronic