ID: 1083220060

View in Genome Browser
Species Human (GRCh38)
Location 11:61246434-61246456
Sequence ATGGTATCTTTGGGGGCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083220060_1083220068 6 Left 1083220060 11:61246434-61246456 CCCTTGGCCCCCAAAGATACCAT 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1083220068 11:61246463-61246485 TGAATACAGTTAGCCAGGCATGG 0: 1
1: 0
2: 16
3: 251
4: 2975
1083220060_1083220067 1 Left 1083220060 11:61246434-61246456 CCCTTGGCCCCCAAAGATACCAT 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1083220067 11:61246458-61246480 TAAAGTGAATACAGTTAGCCAGG 0: 1
1: 0
2: 2
3: 20
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083220060 Original CRISPR ATGGTATCTTTGGGGGCCAA GGG (reversed) Intronic
900327073 1:2113674-2113696 GTGGTATCTCTGAGAGCCAATGG + Intronic
901127615 1:6940647-6940669 ATGGGCCTTTTGGGGGCCAAGGG + Intronic
902308574 1:15562838-15562860 ATGGTTTCTGTGGGGGCCTGAGG - Intronic
903028071 1:20443539-20443561 AAAAGATCTTTGGGGGCCAAAGG + Intergenic
909525876 1:76622164-76622186 ATGGTTCCTTTGGGGGCCTTTGG - Intronic
911541710 1:99164789-99164811 ATGAGATCTGGGGGGGCCAAGGG + Intergenic
920314541 1:205068047-205068069 ATGGTTTCTTTGGGAGCAGATGG + Intronic
920588484 1:207193235-207193257 ATGATGTATTTGGGGACCAATGG + Intergenic
921850714 1:219929365-219929387 CTGGTTTCTTTGGCGGCCAAGGG - Intronic
1063327471 10:5118798-5118820 ATGGCAGCTATAGGGGCCAAGGG - Intronic
1065565989 10:27010239-27010261 ATGGTTTCTTTGTGGGGCACTGG - Intronic
1067035729 10:42915100-42915122 TGTGTATCTTTGGGGGCCAGAGG - Intergenic
1067237792 10:44466237-44466259 ATGGAATTTTTGGGGGGCAAAGG + Intergenic
1067998280 10:51301277-51301299 TTGGTATGTTTGGGAGTCAAAGG + Intronic
1068112975 10:52703312-52703334 TTGGTTTATTTGGGGGCCAGGGG - Intergenic
1068782122 10:60931292-60931314 AAGGTTTCTTTGGGGGATAATGG - Intronic
1068833780 10:61528700-61528722 ATGCTATCATTGGGGGGAAATGG + Intergenic
1071293484 10:84203286-84203308 ATGGTCTAGTTGGGGGCAAAAGG - Intronic
1071308315 10:84319618-84319640 ATGGTTGCCTTGGGGGCAAATGG - Intergenic
1072176778 10:92932263-92932285 ATGGGATCAGTGGTGGCCAAGGG + Intronic
1072584825 10:96772327-96772349 ATGGTATCTATAGGAGCAAATGG - Intergenic
1074670721 10:115787702-115787724 ATGATATCTTTTGGGGGAAATGG - Intronic
1076105023 10:127814970-127814992 ATGGTATCTTTGGGATTCCATGG - Intergenic
1076820531 10:132936612-132936634 ATGGTGTGTTTGGATGCCAAGGG - Intronic
1076981105 11:205268-205290 CTGGTGTCTGTGGGTGCCAAGGG - Exonic
1082738492 11:56883834-56883856 ATGGTATCTTTGGGGGCACAGGG - Intergenic
1083220060 11:61246434-61246456 ATGGTATCTTTGGGGGCCAAGGG - Intronic
1086858547 11:91896884-91896906 ATGTTGTCTTTAGTGGCCAAGGG - Intergenic
1089350479 11:117819154-117819176 AGGGTGTGTTTGGGGGCCAGAGG - Intronic
1089949295 11:122510280-122510302 ATGGAACATTTGGGCGCCAAAGG + Intergenic
1096262067 12:50099201-50099223 ATGGGAACTTTGTGGGGCAAAGG - Exonic
1098705591 12:73685055-73685077 ATTGGTTCTTTGGGGCCCAACGG - Intergenic
1098968740 12:76825209-76825231 ATGTTACCATTGGGGGACAAAGG + Intronic
1101396657 12:104354699-104354721 ATGCTCACTTTGAGGGCCAAGGG - Intergenic
1101410574 12:104464461-104464483 ATGGTCTAGTTGGGGGTCAAGGG - Intronic
1103587938 12:121970135-121970157 ATGGTAGCAGTTGGGGCCAAGGG - Intronic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1105886093 13:24642858-24642880 ATGGTAAATTTGGGGGTTAAGGG - Intergenic
1107681050 13:42851008-42851030 ATGGAAACTTTTGAGGCCAATGG - Intergenic
1117043210 14:51786774-51786796 ATGATCTCTTTGGTGGCCCATGG + Intergenic
1122184688 14:99982372-99982394 ATGGTATTTTTGGGACCAAAGGG + Intronic
1125636598 15:41193852-41193874 AAGTTATCTTTGGGGGCCATTGG - Intronic
1125891482 15:43270214-43270236 AGGGTAACTGTGGTGGCCAAAGG + Intergenic
1126654776 15:50965395-50965417 ATGCCATCTTTGGAGGCCCAAGG - Intronic
1127100955 15:55564436-55564458 ATGGTATCTTTTTGAGGCAATGG + Intronic
1128223358 15:65983907-65983929 ATGTGATCTTTGGGGGCTGAAGG + Intronic
1129592519 15:76930261-76930283 ATGGGAGTTTTGGGGGCCAAGGG - Intergenic
1133420087 16:5638538-5638560 GTGGCATCTTTGGGGCCTAAAGG + Intergenic
1134541528 16:15070702-15070724 AAGGTATCTTTATGGGCCACTGG + Intronic
1135099712 16:19595108-19595130 ATGGTGGCCTTGGGGGCCACTGG + Intronic
1137438248 16:48476021-48476043 ATGGTGTCTTTGGGGGAACATGG + Intergenic
1137669613 16:50271709-50271731 GTGGGAACTGTGGGGGCCAAGGG - Intronic
1138719625 16:59064297-59064319 CTGGTAGCATTGGAGGCCAATGG + Intergenic
1138803556 16:60064635-60064657 AAGGAATCATTGGGGGTCAAAGG - Intergenic
1145824281 17:27865405-27865427 TTGGTATCTGTGGGGGCTACTGG + Intronic
1149301896 17:55312979-55313001 AAGGTATCTTTGGGGAGAAACGG + Intronic
1149336301 17:55639833-55639855 ATGGCATGTTTGGGGGATAAAGG - Intergenic
1149609548 17:57950133-57950155 GTGGAAGCTGTGGGGGCCAAGGG - Intronic
1151386733 17:73759620-73759642 ATGGTATCTTGGCGGGGGAAGGG + Intergenic
1153136491 18:1923407-1923429 ATGGTAAATTTGGGGGTTAAGGG - Intergenic
1153497715 18:5717190-5717212 ATGTTATGTTTCGGAGCCAAAGG - Intergenic
1154383224 18:13871013-13871035 CTGGTCTCCTTGGGGCCCAAAGG - Intergenic
1156772922 18:40751006-40751028 ATGGTTTCTTTGGGGGGTAGTGG + Intergenic
1159097080 18:63915631-63915653 ATAGTGTATTTGGGCGCCAAAGG + Exonic
1159273091 18:66178880-66178902 ATGCTATCTTAGAGTGCCAAGGG - Intergenic
1161119530 19:2517842-2517864 CAGGTATCCTTGGGGTCCAAAGG - Intronic
1161763104 19:6188747-6188769 AGGGGATCTTTGGGGGTGAAGGG + Intronic
1164422956 19:28113241-28113263 TTAGTAGCTTTGGGGTCCAAGGG - Intergenic
925777326 2:7347947-7347969 ATGGTTTCCTTGGTGGCAAATGG - Intergenic
926705790 2:15836551-15836573 AAGGGGTCTTTGGGGGCCGATGG - Intergenic
927954865 2:27201178-27201200 CTGGGGTCTCTGGGGGCCAAGGG - Intronic
928113938 2:28532199-28532221 ATGGCAGCCTTGGGGACCAAGGG + Intronic
928400840 2:30977685-30977707 ATGGTCTGTTTGAGGGTCAAGGG + Intronic
930744719 2:54870407-54870429 AAGGTATATTTGGGGGAAAAAGG + Intronic
933633403 2:84681576-84681598 CTGAGATATTTGGGGGCCAATGG - Intronic
938141635 2:128799373-128799395 ATGACACCTTTGGGGGCCAGTGG - Intergenic
942210256 2:173663108-173663130 ATGGCCTCTTTGGTGGGCAATGG - Intergenic
945293661 2:208149556-208149578 ATGGGATCTTTGGGGCCCATAGG - Intergenic
947053988 2:226079422-226079444 ATGGCTTCATTGGGGGCCACTGG + Intergenic
947829118 2:233126287-233126309 AGGATTTCTTTGGGGGGCAATGG - Intronic
948134820 2:235628542-235628564 AGGGTATCTTTGGGGGAAGATGG + Intronic
1169659610 20:7963780-7963802 ATGGCATCTTTGTGGGCCTCAGG - Intergenic
1171156054 20:22875546-22875568 ATGGAACCTTTGGGGGGCTAGGG - Intergenic
1173174633 20:40754989-40755011 ATGGTGTCTTAGGGAGCAAAGGG - Intergenic
1174877086 20:54238585-54238607 ATTGTATCTTTGGAGATCAAAGG + Intergenic
1177631330 21:23732741-23732763 ATGTTATCTTTGGGGGATTAAGG - Intergenic
1183152828 22:36051514-36051536 ATGTTATCTTGGAGGGCCTATGG - Intergenic
1183740972 22:39668427-39668449 ATGGTGTCCTTGGGGCCCAGTGG + Intronic
1184079687 22:42210604-42210626 CTGGTATCTGTGGGGGCTGAGGG + Exonic
952047970 3:29346902-29346924 ATGTTATGTTTGCAGGCCAAAGG - Intronic
952561851 3:34604171-34604193 ATGGCATTCTTGGGGGCCTAGGG - Intergenic
955892757 3:63667395-63667417 ATGGCAACCTTGGTGGCCAATGG + Intronic
959871670 3:111335767-111335789 CTGGTAACTTTGGAGGCCAAAGG + Intronic
960129682 3:114042426-114042448 TTGGTATCTGTGGGGGCCAGGGG + Intronic
961257592 3:125570239-125570261 ATTGTATCTTTGGGAGGCCAGGG + Intronic
963208840 3:142666094-142666116 ATGGAGTATTTGGGGGCCACTGG + Intronic
964586362 3:158308705-158308727 ATGGTATCTGTGGATGTCAAGGG + Intronic
965695177 3:171400801-171400823 TTGGTATCTTTGGGGGCATATGG - Intronic
972963771 4:44485805-44485827 TTGGGATCATTGGGGGCCAAGGG - Intergenic
975604312 4:76138337-76138359 AGATTTTCTTTGGGGGCCAAAGG - Intronic
976979886 4:91214393-91214415 ATGGTCTCTTTATGGGCAAAAGG - Intronic
978138458 4:105290948-105290970 TTGGTATCTTTGGGGGATCAAGG + Intergenic
978520884 4:109613855-109613877 ATGTTACCTTTGGGGGAAAATGG - Intronic
981108345 4:140906477-140906499 TTGGTATCTTTGGGGGAAAGGGG + Intronic
983180368 4:164641562-164641584 ATGGTATCTTTGGGAGGCCAAGG + Intergenic
983417677 4:167479684-167479706 ATGCTAGCTGTGGTGGCCAAAGG + Intergenic
984026860 4:174552852-174552874 ATGGTATACATGGGGGCAAATGG + Intergenic
984387622 4:179082962-179082984 ATGGGATCTCTGTTGGCCAAAGG - Intergenic
987489071 5:18554010-18554032 ATGTTATCTTTGGGAGCTATTGG + Intergenic
990697539 5:58437640-58437662 CTGATATCTTTAGGGGCCTATGG + Intergenic
990993405 5:61707328-61707350 ATGATATTATTGGGGTCCAAAGG - Intronic
992650600 5:78855608-78855630 ATGGTAGCTATGTGGGCCACAGG + Intronic
998518426 5:142777751-142777773 GTGGGATGTTTGGGGGCCAGTGG + Intronic
1001365123 5:171129621-171129643 ATGGTAGCTTTGGTGGCCACTGG - Intronic
1002122411 5:177015758-177015780 ATGGTATCTTTAGGGACGCAGGG - Intronic
1003335714 6:5170131-5170153 CTGGCATCTTTGGATGCCAAAGG + Intronic
1005727722 6:28665901-28665923 ATGAGATCTGTGGAGGCCAAAGG - Intergenic
1007943626 6:45805360-45805382 ATGGTATTTTTAGGGCTCAAAGG + Intergenic
1008103380 6:47416614-47416636 ATGTTATCTTTGGGAGCAATTGG + Intergenic
1010406980 6:75516782-75516804 ATGGTAACTTGGTGGACCAAGGG + Intergenic
1011507033 6:88056662-88056684 ATGTTATCTTAGAGGGCAAAGGG - Intronic
1013654337 6:112229563-112229585 ATGGTCTCACTGGGGGCCATAGG + Intronic
1015972668 6:138758463-138758485 ATTGTATCCTTCTGGGCCAATGG - Intronic
1018424747 6:163670339-163670361 ATGTTATCTTTGGTGGCCTGGGG - Intergenic
1019349630 7:548523-548545 ATGGTAAACTTGGGGTCCAAGGG - Intergenic
1025078345 7:55962663-55962685 CTGGTAATCTTGGGGGCCAAGGG - Intronic
1028220421 7:88190168-88190190 AAGGTATGTTTGTGTGCCAATGG - Intronic
1030403162 7:109078231-109078253 TGGATATCTTTGGGGGCCCATGG + Intergenic
1033888245 7:145975104-145975126 CTGGGATTTTTGGGGACCAAAGG - Intergenic
1034409615 7:150933227-150933249 GTAGTATATCTGGGGGCCAAGGG + Intergenic
1040681758 8:49819604-49819626 AGTGTATCCTTGGGGGACAATGG - Intergenic
1042558157 8:70051401-70051423 ATTGTATAATTGGGGGCCCAAGG + Intergenic
1046686095 8:117228367-117228389 AGGGTCTCTTTAGGGGCGAAGGG + Intergenic
1051094078 9:13445087-13445109 ATGGTATTTTTCAGGGCAAAAGG + Intergenic
1052033144 9:23650958-23650980 ATTGTTTCTTTGGGGGCATATGG - Intergenic
1055732999 9:79298299-79298321 ATGGAATTTATGGTGGCCAAGGG + Intergenic
1059071040 9:111136206-111136228 ATGGTAATTTTGGGGGAAAAAGG - Intergenic
1062020116 9:134315449-134315471 ATGGGAGCCTTGGGGGGCAAAGG - Intergenic
1062171218 9:135135912-135135934 ATGGCATCCCTGGGGGCCACAGG + Intergenic
1186274657 X:7926905-7926927 AGGGTTTCCTTGGGGGCCCAAGG + Intronic
1188460460 X:30420964-30420986 ATGGTAACTATGGGTGGCAATGG - Intergenic
1189080659 X:37968531-37968553 ATGGTAAATTTGGGGGTTAAGGG - Intronic
1191862924 X:65680652-65680674 GTGGTAGCTTTGTGGGCCCAAGG + Intronic
1193538613 X:82743196-82743218 ATGGTAAATTTGGGGGTTAAGGG - Intergenic
1193709242 X:84859314-84859336 ATAGTACATTTGGGGGCTAAGGG - Intergenic
1193710297 X:84871097-84871119 ATAGTACATTTGGGGGCTAAGGG + Intergenic
1195416248 X:104622626-104622648 ATAGTGTCTCTGGGGGACAATGG + Intronic
1195546656 X:106119654-106119676 ATGGTAAATTTGGGTGCTAAGGG - Intergenic