ID: 1083220124

View in Genome Browser
Species Human (GRCh38)
Location 11:61247036-61247058
Sequence TGTTATGCAAGAATACCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083220122_1083220124 4 Left 1083220122 11:61247009-61247031 CCAAATGTCAGTTTGGGCTGAGT 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1083220124 11:61247036-61247058 TGTTATGCAAGAATACCTGAGGG 0: 1
1: 0
2: 2
3: 18
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083220124 Original CRISPR TGTTATGCAAGAATACCTGA GGG Intronic
901711133 1:11116190-11116212 TATTATGCAAAAATATCAGAAGG + Intronic
909130269 1:71726911-71726933 TGTCAGGGAAGCATACCTGAAGG - Intronic
911080091 1:93920197-93920219 TGTTATGTAAGATTGCCTGGAGG + Intergenic
912586413 1:110771035-110771057 TGTTATGCAGCTCTACCTGAAGG - Intergenic
912656840 1:111493567-111493589 TGCTATAAGAGAATACCTGAGGG - Intronic
914264889 1:146030207-146030229 TGCTATAAAGGAATACCTGAGGG + Intergenic
916567994 1:165998508-165998530 TGTTTTGTAAGAAAACCTGATGG + Intergenic
917636875 1:176945555-176945577 TGTCATCCAAGGATACCTAAGGG - Intronic
918115949 1:181497726-181497748 TGTTAGGGAAGAGTACCTGCTGG - Intronic
919069210 1:192732759-192732781 AGTTATGTAAGTATACTTGAAGG + Intergenic
919184412 1:194126233-194126255 TGTTAAGCCAGAATTCCTGGAGG + Intergenic
919519475 1:198569901-198569923 TATTATGCAGCAATACCCGATGG - Intergenic
921127952 1:212194940-212194962 TGATGAGCTAGAATACCTGATGG + Intergenic
923046618 1:230360737-230360759 TGCTATGAAGAAATACCTGAGGG - Intronic
923802433 1:237223171-237223193 TGTTATGACAGAATACCAAATGG + Intronic
924584062 1:245346241-245346263 TGCTATAAAAAAATACCTGAGGG - Intronic
1065495515 10:26323547-26323569 TGTATTTCAAGAATACCTAAGGG + Intergenic
1068040507 10:51818705-51818727 TGTTGTAAAAGAATACCAGAGGG + Intronic
1068139696 10:52990617-52990639 TGTTATAAAGGAATACCTGAAGG + Intergenic
1069283145 10:66680532-66680554 TATTATAGATGAATACCTGAAGG - Intronic
1071858434 10:89648658-89648680 TGTTATGTAAGAATAACCTAGGG + Intergenic
1079772201 11:24476114-24476136 TGTTATAAAGAAATACCTGAGGG + Intergenic
1081180785 11:39983949-39983971 TGCTATGAAGAAATACCTGATGG - Intergenic
1082149040 11:48709135-48709157 TGTTTTGGAAGAATTCATGAAGG - Intergenic
1082585046 11:54926833-54926855 CGTTATGGCAGAATCCCTGAAGG - Intergenic
1082585117 11:54927693-54927715 TGTTATGGTGGAATCCCTGAAGG - Intergenic
1082588854 11:54979768-54979790 TGTTTTGAAAGAATTCATGAAGG + Intergenic
1082593376 11:55043330-55043352 TGTTCTGGCAGAATCCCTGAAGG - Intergenic
1082593791 11:55048918-55048940 TGTTTTGGCAGAATACATGAAGG - Intergenic
1083220124 11:61247036-61247058 TGTTATGCAAGAATACCTGAGGG + Intronic
1087389394 11:97514670-97514692 TGTTAGGCAAGTATTCCTGCAGG + Intergenic
1089292647 11:117447303-117447325 TGTTTTAGAAGAATATCTGATGG + Intronic
1091461903 12:649891-649913 TGTTTTGGAAGAATACTTAAGGG - Intronic
1091969935 12:4778722-4778744 TTTTATTAAAAAATACCTGAAGG - Intronic
1094062957 12:26334287-26334309 TCCTATGCAAGTAGACCTGAGGG + Intergenic
1094165667 12:27440333-27440355 TGTTGTGCAAGAAAAGCTAACGG + Intergenic
1095398173 12:41784681-41784703 TGTTTTTCAAGAATTCCTGCAGG - Intergenic
1097098872 12:56571964-56571986 TATTATTCAAAAATACTTGATGG + Intronic
1097480294 12:60115930-60115952 TGCTATAAAGGAATACCTGAGGG + Intergenic
1099254040 12:80293717-80293739 TGTTTTGCAGGAAGATCTGAGGG - Intronic
1100380733 12:94059362-94059384 TGCTATAAAGGAATACCTGAGGG - Intergenic
1100650395 12:96581805-96581827 TGTTTTGGAAGAATACTTAATGG - Intronic
1105249691 13:18686819-18686841 TGGTATCCCAGAATACATGAAGG + Intergenic
1105616272 13:22015962-22015984 TGTTATGCCATAAAAACTGATGG - Intergenic
1106948042 13:34850355-34850377 TGTTGTGCAAGAATGGCTTAGGG - Intergenic
1107740242 13:43442737-43442759 TGATTTGCAAGAAGAACTGAGGG - Intronic
1108049024 13:46411260-46411282 TGCTTTGCAAGAGTTCCTGAAGG + Intronic
1109020645 13:57087176-57087198 TGTTATGCAATTCTCCCTGAAGG - Intergenic
1109541547 13:63784533-63784555 TGCTTTGCAAGAGTTCCTGAAGG + Intergenic
1111396941 13:87676909-87676931 TGTTATTCAAGAATAGCAGCTGG - Exonic
1112901993 13:104368209-104368231 TCTTATGCACAAATGCCTGACGG + Intergenic
1112920890 13:104611623-104611645 TTTTATGAAAGAAATCCTGATGG - Intergenic
1114016817 14:18437786-18437808 TGTTCTGGAATACTACCTGAGGG + Intergenic
1114016914 14:18438741-18438763 TGTTTTGGAAAACTACCTGAGGG + Intergenic
1114024910 14:18516588-18516610 TGTTCTGGAATAATATCTGAGGG - Intergenic
1114790798 14:25656076-25656098 AGTTATGTAAAAATGCCTGATGG - Intergenic
1115059328 14:29170702-29170724 GGTGATGAAAGAATACCTGAAGG + Intergenic
1115805879 14:37051248-37051270 TATCATTAAAGAATACCTGAGGG + Intronic
1116161729 14:41275337-41275359 TGTTATACATGAAAACCTAAAGG + Intergenic
1116640244 14:47452573-47452595 TGTTTTGGAAGAATTCCTAAAGG - Intronic
1116836213 14:49770771-49770793 TGTTAGGAATTAATACCTGAAGG + Intronic
1117233034 14:53741809-53741831 TGATGTCCAAGAATACTTGAGGG + Intergenic
1118279171 14:64412938-64412960 TGTGAAGAAAGAATACCTGGAGG - Intronic
1120120757 14:80678127-80678149 TGTTATGCGTGAATTCCTGAAGG + Intronic
1120685448 14:87531751-87531773 TGTCATGCAAGAATATAAGAGGG - Intergenic
1122453193 14:101828440-101828462 TGATATATAAGAAGACCTGAAGG + Intronic
1124472512 15:30000851-30000873 TGCTATAAAGGAATACCTGAGGG - Intergenic
1125025213 15:35022906-35022928 TTTTTTGCAAGAATACCTTCAGG + Intergenic
1126993711 15:54415322-54415344 TCATATGCAAGAATACTTTATGG + Intronic
1127212734 15:56790958-56790980 ACTTATGCAAGAATATCTGCAGG + Intronic
1129497850 15:76003913-76003935 TGTTCTGCAAGAAAAACTCAGGG + Intronic
1129619887 15:77134621-77134643 TGTTATACAATAAGCCCTGAAGG - Intronic
1133346920 16:5077496-5077518 TGCTATGCGAGAAGACCTGGCGG + Exonic
1133585506 16:7190462-7190484 TGATATGTAAAAATACCTGTTGG - Intronic
1135508054 16:23056193-23056215 TCTTATGTAAGATGACCTGAAGG + Intergenic
1137235219 16:46610933-46610955 TTTTTTGCAAGAATACTTCAAGG + Intronic
1137848994 16:51719722-51719744 AGTTATGCGAGAATTCCTGGTGG - Intergenic
1139027627 16:62838261-62838283 TGTTTAGCAAGAATTCCTGGAGG - Intergenic
1139617917 16:68111789-68111811 TGCTTTACAAGAATTCCTGAAGG - Intronic
1139852165 16:69957877-69957899 TGTCATGCAATAAAACCTAATGG - Intronic
1139881136 16:70180781-70180803 TGTCATGCAATAAAACCTAATGG - Intronic
1140371369 16:74414737-74414759 TGTCATGCAATAAAACCTAATGG + Intronic
1140912198 16:79464396-79464418 TGTTGTCCAAGAATATATGATGG + Intergenic
1143662919 17:8338125-8338147 TGCTATAACAGAATACCTGAGGG + Intergenic
1144427118 17:15153621-15153643 TGCTATAAAGGAATACCTGATGG + Intergenic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1149011405 17:51860495-51860517 AGATATGCAAGAATAACTGGAGG + Intronic
1157192225 18:45591174-45591196 TGATATGCAAATATCCCTGAGGG + Intronic
1157226465 18:45869687-45869709 TGAAATGCAAGAAAAGCTGAGGG - Intronic
1158329691 18:56347901-56347923 TGTCATTCAAGCATTCCTGATGG - Intergenic
1163981364 19:20903386-20903408 TGTTATGAAAGAGTGGCTGATGG - Intergenic
1164364864 19:27567138-27567160 TGTTTTGCTAGAATATGTGAAGG + Intergenic
925489106 2:4372333-4372355 TGTTTTGCAAGAATTCCACAAGG - Intergenic
928696546 2:33855323-33855345 TTTTATGCCGGAATTCCTGAAGG + Intergenic
929625021 2:43397648-43397670 TGTTTTGCAGGCATACTTGATGG + Intronic
931417136 2:62091877-62091899 TGTTAGGCAAGTATTCCTGCAGG + Intronic
934844325 2:97652651-97652673 GGTGATGCAAGAATACCAGAGGG + Intergenic
936655638 2:114483417-114483439 TGTTATTCATGAATACTTTATGG - Intronic
936867890 2:117097398-117097420 TGTTATGAAAGTATACTTGTAGG + Intergenic
936868538 2:117106734-117106756 TGTCTTGCAAGAGCACCTGAAGG - Intergenic
937893751 2:126961789-126961811 TGTCTTCCAAGAATTCCTGAAGG - Intergenic
940927615 2:159382877-159382899 TTGTATGCAAAAATACCTTATGG + Intronic
941088336 2:161145501-161145523 TGTCTTGCAAGAGTTCCTGAAGG - Intronic
941137782 2:161738994-161739016 TCTTATGCTAGAATTCCTGAGGG - Intronic
942188887 2:173451409-173451431 CTTTATGCAAAAATACCTGTAGG - Intergenic
942662752 2:178283635-178283657 TGTCATAAAGGAATACCTGAGGG + Intronic
943644001 2:190388820-190388842 TATTATGCAAGAATATTTTAAGG + Intergenic
946136034 2:217647824-217647846 TGATATGCAAGAATAAATGCAGG + Intronic
946649177 2:221872358-221872380 TGCTATAAAAGAAGACCTGAGGG + Intergenic
1170540572 20:17383300-17383322 TGTTATGAAAGAAAAGCTGCAGG + Intronic
1173557433 20:43976133-43976155 TGTTATGCAGGAAAAACTAACGG - Intronic
1173584168 20:44169476-44169498 TGCTGTAAAAGAATACCTGAGGG - Intronic
1175294533 20:57899289-57899311 TGCTATAAAAGAATACCTGAAGG + Intergenic
1176456542 21:6917339-6917361 TGGTATCCCAGAATACATGAAGG + Intergenic
1176834714 21:13782401-13782423 TGGTATCCCAGAATACATGAAGG + Intergenic
1177556465 21:22695610-22695632 TGTCTTGCAAGAGTTCCTGAAGG - Intergenic
1180441322 22:15368659-15368681 TGTTCTGGAATACTACCTGAGGG + Intergenic
1180441419 22:15369614-15369636 TGTTTTGGAAAACTACCTGAGGG + Intergenic
1180449076 22:15444069-15444091 TGTTCTGGAATAATATCTGAGGG - Intergenic
1183724214 22:39579443-39579465 TGCTGTGTAAGAATACCCGAGGG + Intronic
949740627 3:7229593-7229615 TATTCTGCAAGAATAACGGAAGG + Intronic
951645611 3:24887595-24887617 TGTAATGAAAGAATAGCTGTAGG + Intergenic
954840842 3:53509829-53509851 TGTTATGCAGGAATCCCTGACGG - Intronic
955818048 3:62867594-62867616 TAAAATGCAAGAATACCAGAAGG - Intronic
956145690 3:66188698-66188720 TGTTATAAACGAAAACCTGAGGG - Intronic
956788995 3:72666172-72666194 GGCTATGCAAGAATACCTGGAGG + Intergenic
957112907 3:75989510-75989532 TGTTTTCCAATAATACCTGTTGG + Intronic
957913218 3:86650257-86650279 TGTTATGCATAACTAGCTGAGGG + Intergenic
958720127 3:97833782-97833804 TGCTATAAAGGAATACCTGAGGG + Intronic
964194671 3:154048721-154048743 TGTTATGTAATAATAGATGAAGG + Intergenic
965581964 3:170278357-170278379 TGTTACAAAGGAATACCTGAAGG + Intronic
966348774 3:179006837-179006859 TGTTATGCAAGAAATGCTAAAGG + Intergenic
966607856 3:181839347-181839369 TGTTCTGCAAGCACACCTGGTGG - Intergenic
967479200 3:189954922-189954944 GGTTATGCAAGAATGCCTGTGGG - Intergenic
967546001 3:190729152-190729174 TGCTAAGCAAAAGTACCTGAGGG + Intergenic
969345433 4:6567017-6567039 TGTTTTGCAGGAAGAGCTGACGG - Intergenic
970374777 4:15446189-15446211 TGCTATAAAGGAATACCTGAGGG + Intergenic
970951928 4:21766329-21766351 CTTTATGCAAGAATAACTAAGGG + Intronic
975492673 4:75005766-75005788 TTTGCTGCAAGAATAGCTGACGG - Intronic
976216882 4:82723664-82723686 TATTTGGCAAGAATGCCTGAAGG - Intronic
976589432 4:86834381-86834403 TGCCATGAAGGAATACCTGAGGG - Intronic
978011862 4:103696783-103696805 AGTTATGGAAGAATAACTGATGG - Intronic
978978624 4:114913689-114913711 TGGTATGCAAGAACCCCTGTGGG + Intronic
980400664 4:132280367-132280389 TGCTATGAAAGAATACCTGAGGG - Intergenic
981472095 4:145148109-145148131 TGGTATGTAAAAATACTTGATGG - Intronic
981657421 4:147127690-147127712 TGCTATGAAGAAATACCTGAGGG + Intergenic
981808726 4:148748771-148748793 TATTATCCAAGAATAATTGAAGG - Intergenic
982396130 4:154917857-154917879 TGTTATTCACAAATACCAGAAGG - Intergenic
982817571 4:159905421-159905443 TGTTATGCAAAAGAACCAGAAGG - Intergenic
993147010 5:84107329-84107351 TGTTGTGGAAGCATAACTGATGG - Intronic
995171002 5:109111895-109111917 TTTTATGCAAGAATTTCTTATGG - Intronic
996836270 5:127796139-127796161 TGATATGCCAGTATATCTGATGG + Intergenic
996857247 5:128022679-128022701 TCTTATGGATGAATACATGAAGG + Intergenic
997126909 5:131236189-131236211 AATTATGCAAAAATTCCTGAAGG - Intergenic
997270576 5:132533679-132533701 AATAATGCAAGAATACCTGCAGG - Intergenic
1000242779 5:159423976-159423998 TGTTAGGCAAAAATACTGGAAGG - Intergenic
1000314479 5:160075306-160075328 TGTTATTCCAGAGTACATGAAGG - Intronic
1000408189 5:160911024-160911046 TGCTATGAAGGAATACCTGAGGG - Intergenic
1000720093 5:164694896-164694918 TGCTCTGCAAGAGTTCCTGAAGG + Intergenic
1002999818 6:2320332-2320354 TCTTATGCTAGAATTCCTAAGGG - Intergenic
1005921323 6:30404550-30404572 CATTATGCAAGAATTCCTCAGGG + Intergenic
1006758796 6:36441193-36441215 TGTTTTGCAGGAATATCAGAAGG + Intronic
1010504519 6:76640967-76640989 TGTTATGCGAAGATAGCTGAAGG + Intergenic
1010866834 6:80985696-80985718 GGCTATGCAAGTATACCAGAAGG - Intergenic
1011282882 6:85694234-85694256 TGTTATGCAACATTGTCTGAAGG + Intergenic
1012033533 6:94102609-94102631 TCTTATGCAGAAATACCTGAAGG - Intergenic
1012676956 6:102127301-102127323 TGCTATGAAGGAATACCTGAGGG + Intergenic
1013153738 6:107473041-107473063 CTTTTTGTAAGAATACCTGAGGG - Intergenic
1013512239 6:110855733-110855755 TGTAACCAAAGAATACCTGATGG - Intronic
1013617955 6:111862227-111862249 TCTTATGGATGAAAACCTGATGG + Intronic
1014336009 6:120138369-120138391 TTTTATAGAAGAATATCTGAAGG + Intergenic
1016642150 6:146361397-146361419 TGTTATGCAAGCAAACATCAGGG + Intronic
1019222423 6:170484266-170484288 TCTCATTCAATAATACCTGATGG + Intergenic
1019354723 7:572528-572550 TGTGAGGCATGAATACCTGCAGG - Intronic
1025582095 7:62732666-62732688 TGTTCTGGAAGAATCCCTGAAGG + Intergenic
1025585763 7:62784564-62784586 TGTTTTGGCAGAATTCCTGAAGG + Intergenic
1026454868 7:70562195-70562217 TGCTATAAAGGAATACCTGAGGG - Intronic
1026486223 7:70824013-70824035 TGCTATAAAGGAATACCTGAGGG + Intergenic
1027576042 7:79932576-79932598 TGCTTTGCAAGAACTCCTGAAGG - Intergenic
1027970981 7:85081127-85081149 TGTGATGCTAAAATAACTGAAGG + Intronic
1028878763 7:95855105-95855127 TGTTTTACAAGAAAAACTGAAGG - Intronic
1030424319 7:109354314-109354336 TGCTATAAAGGAATACCTGAGGG - Intergenic
1032365317 7:131293373-131293395 TGTTATGCAGTAATAGCTAATGG + Intronic
1035987752 8:4453498-4453520 TCTGATGCAAGAAGGCCTGAAGG - Intronic
1038133790 8:24763910-24763932 TCTTCTCCAAGAATACCAGAGGG - Intergenic
1038745658 8:30252681-30252703 TGTTAAGCAAGAATACATAATGG - Intergenic
1039179076 8:34843553-34843575 TGTTATAGAAGATTTCCTGAAGG - Intergenic
1041482192 8:58333698-58333720 TGTCTTGCAAGAACTCCTGAAGG + Intergenic
1041874418 8:62671304-62671326 TGTTTGTCAAGAATGCCTGAAGG - Intronic
1041892193 8:62881734-62881756 TGTTTTGCATGAATACCAAAAGG + Intronic
1042148634 8:65758267-65758289 CCTTATGCCAGAATTCCTGAGGG - Intronic
1042898603 8:73697408-73697430 TGTTCTACAAGAAATCCTGAAGG + Intronic
1046901432 8:119527913-119527935 TCTTATGTTAGAATGCCTGAGGG - Intergenic
1047088268 8:121543858-121543880 TGTTATGCAGCAACAGCTGATGG + Intergenic
1048508820 8:135044091-135044113 TGTTATGGAAGACTTCCTGGAGG + Intergenic
1049983685 9:928380-928402 TTTTATGCAAGTATACATGGGGG - Intronic
1050821662 9:9887055-9887077 TGTTTTGCAACAATACATAATGG + Intronic
1051214276 9:14779533-14779555 TGAATTGCAAGAATGCCTGACGG + Intronic
1051711770 9:19938152-19938174 TTTTCTGCAAGAATATCTAATGG - Intergenic
1057340904 9:94200415-94200437 TGCTATGAAGGAATACTTGAAGG + Intergenic
1057595109 9:96409258-96409280 TGCTATAAAAGAATACCTGAAGG - Intronic
1058128839 9:101226780-101226802 TGTTATACTGGTATACCTGAAGG + Intronic
1060717889 9:125951277-125951299 TGTTCTGCACAAGTACCTGACGG - Intronic
1203494070 Un_GL000224v1:134232-134254 TGTTATGGAATCATACCTGAGGG - Intergenic
1203496330 Un_GL000224v1:154975-154997 TGTTCTGCAATCGTACCTGAGGG + Intergenic
1203506689 Un_KI270741v1:76107-76129 TGTTATGGAATCATACCTGAGGG - Intergenic
1203508952 Un_KI270741v1:96897-96919 TGTTCTGCAATCGTACCTGAGGG + Intergenic
1187491722 X:19758359-19758381 TGAAATGCAAGAATAACTAAGGG + Intronic
1188483308 X:30655768-30655790 TTTTAGGCAACAAAACCTGAGGG - Intronic
1188802258 X:34547176-34547198 TGCTCTGAAGGAATACCTGAGGG + Intergenic
1189127188 X:38461128-38461150 TGCTATGAAGGAATGCCTGAAGG + Intronic
1189560716 X:42188966-42188988 TCTTATCCCATAATACCTGAGGG - Intergenic
1189623219 X:42866266-42866288 TTTTAGGCAAAAATACCTGCAGG - Intergenic
1190125571 X:47702184-47702206 TGTTAGGCAAGAAGAACAGAAGG - Intergenic
1192841824 X:74865007-74865029 TGCTATGAAGAAATACCTGATGG - Intronic
1193019761 X:76779249-76779271 TGTCTTACAAGAATTCCTGAAGG - Intergenic
1193262740 X:79428006-79428028 TGATATAAAGGAATACCTGAGGG - Intergenic
1194178446 X:90683065-90683087 TGCTATGCAAGCAATCCTGATGG - Intergenic
1195272438 X:103245085-103245107 GTCTATGAAAGAATACCTGAAGG - Intergenic
1195516460 X:105781921-105781943 TGTTATGAAAGAATATCTCCAGG + Intergenic
1197895502 X:131309312-131309334 TACTATGACAGAATACCTGAGGG - Intronic
1199172310 X:144745855-144745877 TGTTAGGCAAGTATTCCTGCAGG - Intergenic
1199351176 X:146802524-146802546 TGCTATGAAGAAATACCTGAGGG - Intergenic
1199352731 X:146821969-146821991 TGCTATGAAGAAATACCTGAGGG + Intergenic
1200315380 X:155127148-155127170 TGCTATAAAGGAATACCTGAGGG - Intronic
1200525110 Y:4265230-4265252 TGCTATGCAAGCAATCCTGATGG - Intergenic
1201422607 Y:13816512-13816534 TTTTTTGCAAAAATACCTAAAGG + Intergenic