ID: 1083222816

View in Genome Browser
Species Human (GRCh38)
Location 11:61264646-61264668
Sequence GGGCCTCTTGCACCAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 253}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083222812_1083222816 -4 Left 1083222812 11:61264627-61264649 CCCTGGGCAGTGCCCTCAAGGGC 0: 1
1: 0
2: 2
3: 26
4: 279
Right 1083222816 11:61264646-61264668 GGGCCTCTTGCACCAGCAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 253
1083222805_1083222816 14 Left 1083222805 11:61264609-61264631 CCCAGAGCATCTTGCCTGCCCTG 0: 1
1: 0
2: 1
3: 23
4: 231
Right 1083222816 11:61264646-61264668 GGGCCTCTTGCACCAGCAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 253
1083222803_1083222816 26 Left 1083222803 11:61264597-61264619 CCCATGAGGAAGCCCAGAGCATC 0: 1
1: 0
2: 4
3: 21
4: 159
Right 1083222816 11:61264646-61264668 GGGCCTCTTGCACCAGCAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 253
1083222809_1083222816 0 Left 1083222809 11:61264623-61264645 CCTGCCCTGGGCAGTGCCCTCAA 0: 1
1: 1
2: 3
3: 42
4: 325
Right 1083222816 11:61264646-61264668 GGGCCTCTTGCACCAGCAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 253
1083222802_1083222816 27 Left 1083222802 11:61264596-61264618 CCCCATGAGGAAGCCCAGAGCAT 0: 1
1: 1
2: 4
3: 18
4: 189
Right 1083222816 11:61264646-61264668 GGGCCTCTTGCACCAGCAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 253
1083222806_1083222816 13 Left 1083222806 11:61264610-61264632 CCAGAGCATCTTGCCTGCCCTGG 0: 1
1: 0
2: 2
3: 26
4: 280
Right 1083222816 11:61264646-61264668 GGGCCTCTTGCACCAGCAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 253
1083222804_1083222816 25 Left 1083222804 11:61264598-61264620 CCATGAGGAAGCCCAGAGCATCT 0: 1
1: 0
2: 2
3: 21
4: 270
Right 1083222816 11:61264646-61264668 GGGCCTCTTGCACCAGCAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 253
1083222813_1083222816 -5 Left 1083222813 11:61264628-61264650 CCTGGGCAGTGCCCTCAAGGGCC 0: 1
1: 0
2: 3
3: 25
4: 268
Right 1083222816 11:61264646-61264668 GGGCCTCTTGCACCAGCAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083222816 Original CRISPR GGGCCTCTTGCACCAGCAGC AGG Intronic
900013123 1:132820-132842 AGGTCTCTTGCACCAGAAGGTGG - Intergenic
900043189 1:488807-488829 AGGTCTCTTGCACCAGAAGGTGG - Intergenic
900064626 1:723804-723826 AGGTCTCTTGCACCAGAAGGTGG - Intergenic
900364774 1:2306639-2306661 GGGCCTCGCGCTCCCGCAGCAGG - Exonic
900396635 1:2455736-2455758 GGCCCTCTCACACCTGCAGCAGG - Intronic
900906530 1:5563598-5563620 CGGCCCACTGCACCAGCAGCAGG + Intergenic
900919745 1:5662697-5662719 GGGCCTCCAGCAGCAGCAGAGGG + Intergenic
901325028 1:8360674-8360696 GGGCCTGTGGCGCCGGCAGCTGG + Exonic
902621571 1:17653931-17653953 GGGCCTTTAGCACCAGCAGAGGG + Intronic
903234445 1:21940521-21940543 GGGGTTCTGGAACCAGCAGCTGG + Intergenic
903295758 1:22342248-22342270 GGGCCTCCCGCACCCGCAGCTGG + Intergenic
903451040 1:23453770-23453792 AGGCCTCTGACACCAGCTGCTGG + Intronic
904393241 1:30199438-30199460 GGGCCTCCTGCCACAGCAGGAGG + Intergenic
904468835 1:30723491-30723513 GGGCCTGGAGCAGCAGCAGCAGG + Exonic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
904835993 1:33336728-33336750 GTCCCTCCTGAACCAGCAGCTGG - Intronic
912383417 1:109259781-109259803 GATCCTCTTTTACCAGCAGCTGG - Intronic
912694219 1:111828783-111828805 GGGCCTCATGCAGCAGTGGCTGG - Intronic
912775613 1:112504723-112504745 GGGCCCCTTGTGCAAGCAGCAGG + Intronic
913291327 1:117274880-117274902 GGGCTTCTTGTCCCAGCTGCTGG - Intergenic
914963365 1:152227506-152227528 GTGCCTATTGCACCATCTGCTGG + Intergenic
915586304 1:156845671-156845693 AGGCCTCTTGCGCCTCCAGCGGG + Exonic
915784678 1:158597024-158597046 GGGGCTCCTGTAGCAGCAGCAGG + Intergenic
916422356 1:164648846-164648868 GGGCCTCTAGCCCCAGGGGCAGG + Intronic
916749015 1:167707395-167707417 GGGTTTCTGTCACCAGCAGCTGG - Intergenic
917479235 1:175396667-175396689 GGGCCTCCAGCTCCAGCAGCGGG - Exonic
918662757 1:187109314-187109336 GGGCCTCTTCCAACAGCTGCTGG + Intergenic
919738423 1:200968107-200968129 GAGCCTCCTGCCCCAGGAGCAGG - Intergenic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
921065768 1:211621067-211621089 GGGGCTCTGGAACCAGGAGCAGG + Intergenic
921322347 1:213954092-213954114 GGGCCTCATGCTCCAGCGCCTGG - Intergenic
922099523 1:222469820-222469842 TGGTCTCTTGCACCAGAAGGTGG - Intergenic
922261560 1:223949316-223949338 TGGTCTCTTGCACCAGAAGGTGG - Intergenic
922735518 1:227976428-227976450 AGGTCTCTTGCACCAGAAGGTGG + Intergenic
923014232 1:230113490-230113512 AGGCTTCTTGCCCCAGCAGGTGG - Intronic
923850174 1:237785762-237785784 TGACCTACTGCACCAGCAGCAGG - Intronic
924342725 1:243051492-243051514 AGGTCTCTTGCACCAGAAGGTGG - Intergenic
924811001 1:247402038-247402060 GGGCCTTTTGCCCCAGCCCCTGG - Intergenic
1065204376 10:23343807-23343829 AGGCCCCTTGCTCCAGCCGCTGG - Intronic
1066733753 10:38454062-38454084 AGGTCTCTTGCACCAGAAGGTGG + Intergenic
1067023970 10:42827510-42827532 GGGCACGTTGCAGCAGCAGCTGG + Intronic
1068573728 10:58660106-58660128 GGGCCCTTTGCTCCAGCAGAAGG + Intronic
1068650160 10:59513656-59513678 GGGCCTCAGGCAACAGCAGGAGG - Intergenic
1071293662 10:84204245-84204267 AGGCCTCTTGCACCAACTCCTGG - Intronic
1073107636 10:101041366-101041388 GAGCCTCATGCCCCAGCAGAGGG + Intergenic
1073685250 10:105745348-105745370 TTGACTCTTCCACCAGCAGCTGG - Intergenic
1075263485 10:120981856-120981878 GGGCCTCCTGCCCCAGGAGCAGG + Intergenic
1075665156 10:124224551-124224573 GTGCTTCATGCACCAGCATCAGG + Intergenic
1076314707 10:129532250-129532272 GGGTCCCTTGGGCCAGCAGCTGG + Intronic
1076674223 10:132139998-132140020 GGGCCTCTCACACCAGCTGGCGG + Intronic
1076732962 10:132447368-132447390 GGGCCTCTCCCTCCAGCAGCAGG + Intronic
1076969460 11:125024-125046 AGGTCTCTTGCACCAGAAGGTGG - Intergenic
1077154002 11:1083486-1083508 GGGCCAGCTGCACCTGCAGCCGG - Intergenic
1077487171 11:2844343-2844365 GGGCCTCTGTCACCAGCAGCTGG + Intronic
1078477941 11:11649096-11649118 GTGGCTCTTTCACCAGCATCAGG - Intergenic
1080057176 11:27918246-27918268 GGGCCTCTTGTCCAAGAAGCAGG + Intergenic
1081906948 11:46676153-46676175 CAGCCTCATGCAACAGCAGCTGG - Intergenic
1083222816 11:61264646-61264668 GGGCCTCTTGCACCAGCAGCAGG + Intronic
1083651815 11:64208557-64208579 TGGCCTCCTGGAGCAGCAGCGGG + Intronic
1083688270 11:64390826-64390848 GGGCCTGTGGCTCCAGCAGAGGG + Intergenic
1084150158 11:67284384-67284406 GGGCCTGGTGCCGCAGCAGCCGG - Intronic
1089510966 11:118997001-118997023 GGGCCTATAGCATCAGCATCAGG - Intergenic
1089659858 11:119978741-119978763 GTCCCTCTTGCCCCAGCAGCTGG + Intergenic
1090398928 11:126436091-126436113 GAGCCTCTTTGACCAGGAGCTGG + Intronic
1090933861 11:131324334-131324356 GAGCCTCCGGCACCAGCAGACGG - Intergenic
1092937409 12:13376924-13376946 GGGCATCTTGAATCTGCAGCTGG - Intronic
1094835937 12:34322116-34322138 GGGCCCCATGCAGCAGCTGCTGG + Intergenic
1102200282 12:111053262-111053284 GTGGCTCTTGCCCCAGCAGTGGG + Intronic
1103293846 12:119869401-119869423 GGGTTTCTTTCACCAGCACCTGG + Intronic
1105422639 13:20266532-20266554 GGGTCTCATCCACCACCAGCAGG + Intergenic
1107314001 13:39111451-39111473 AGGTCTCTTGCTCAAGCAGCTGG + Intergenic
1108317256 13:49248757-49248779 GTGCCTCTTGCGAAAGCAGCTGG + Intronic
1108686972 13:52828117-52828139 AGAGCTCTGGCACCAGCAGCAGG + Intergenic
1110596613 13:77326878-77326900 CGGCCTCTGGCTCCCGCAGCAGG + Intronic
1113817104 13:113180011-113180033 GCGCCTCGTGCAGCAGCAGCAGG + Exonic
1120986752 14:90341880-90341902 GGACCTCTGGAACCTGCAGCTGG + Intergenic
1121242239 14:92439272-92439294 GGGCCCTTTGCAGCTGCAGCAGG + Intronic
1122272226 14:100573420-100573442 GGGCCTCGTGCACCCTCATCAGG + Intronic
1122925677 14:104898355-104898377 GGGCCACTTGGGCCAGGAGCTGG - Intergenic
1123425122 15:20164550-20164572 GGGCACGTTGCAGCAGCAGCTGG + Intergenic
1123456500 15:20431149-20431171 GATCCTCTTGCAGCAGCTGCTGG - Intergenic
1123534347 15:21171083-21171105 GGGCACGTTGCAGCAGCAGCTGG + Intergenic
1123661562 15:22569213-22569235 GATCCTCTTGCAGCAGCTGCTGG + Intergenic
1124262639 15:28206296-28206318 GATCCTCTTGCAGCAGCTGCTGG - Exonic
1124315362 15:28663442-28663464 GATCCTCTTGCAGCAGCTGCTGG + Intergenic
1125481364 15:40083218-40083240 GAGCCTCTTGCCCGAGCACCAGG - Intergenic
1125538948 15:40458851-40458873 TGTCCTCTCGCTCCAGCAGCAGG - Exonic
1127356017 15:58200865-58200887 GGGCCACTTTCAGCAGCATCAGG + Intronic
1127560869 15:60134785-60134807 GGCCCTCTAGCTCCAGCAGGTGG + Intergenic
1128808903 15:70555706-70555728 GGACTTGTTGCCCCAGCAGCTGG - Intergenic
1132933463 16:2470056-2470078 TGGCCTCCTCCACCAGCTGCAGG + Intergenic
1136297463 16:29311877-29311899 GGGGCTCTAGCATCAGCAGCCGG - Intergenic
1136859739 16:33691195-33691217 GGGCACGTTGCAGCAGCAGCTGG - Intergenic
1137712245 16:50574501-50574523 GGGCCTCGGCCACCAGCAGCAGG - Intronic
1138555595 16:57769615-57769637 GGGCCTCCTGCAGCAGCAGTGGG + Exonic
1142059014 16:88017954-88017976 GGGGCTCTAGCATCAGCAGCCGG - Intronic
1142099421 16:88263695-88263717 TAGCCCCTTGCAGCAGCAGCAGG + Intergenic
1142154453 16:88526828-88526850 AGGCCTCGTCCACCAGCAGCAGG - Exonic
1142451215 16:90174098-90174120 AGGTCTCTTGCACCAGAAGGTGG + Intergenic
1203121245 16_KI270728v1_random:1539374-1539396 GGGCACGTTGCAGCAGCAGCTGG - Intergenic
1144891939 17:18499355-18499377 GGACATCCTGCAGCAGCAGCTGG - Intergenic
1145140283 17:20444962-20444984 GGACATCCTGCAGCAGCAGCTGG + Intergenic
1145795589 17:27653711-27653733 GGACATCCTGCAGCAGCAGCTGG - Intergenic
1146651116 17:34606999-34607021 GAGCCTTCTGCACAAGCAGCTGG - Intronic
1147999680 17:44380441-44380463 GTGAATCTTGCACCAGTAGCTGG + Exonic
1150285407 17:63951133-63951155 GGGCCCCTCTCACCAGCAGGTGG - Intronic
1151812711 17:76453752-76453774 GGGCCTCCTTCACCAGCTTCTGG - Exonic
1152032419 17:77852691-77852713 GGGCTGCGTGCTCCAGCAGCAGG - Intergenic
1154155118 18:11938063-11938085 GGGCCACTTGCGCCATCTGCTGG - Intergenic
1157610367 18:48951706-48951728 GGGCCTCCTGCCGCCGCAGCTGG - Intergenic
1160247584 18:77171221-77171243 CGGCCTCCCGCACCAGCCGCTGG - Intergenic
1160431970 18:78819009-78819031 GGGCCCCTTGCACCAGCTCCTGG - Intergenic
1160646265 19:194950-194972 AGGTCTCTTGCACCAGAAGGTGG - Intergenic
1160774967 19:851146-851168 AGGCCTCTGGGACCCGCAGCTGG - Intronic
1160897380 19:1409004-1409026 GCGCCTCTCGCACCAGCTACAGG + Intronic
1161820977 19:6531282-6531304 CGGCCTCTTGGACCTGCGGCAGG + Exonic
1162335645 19:10058691-10058713 GGTCCTCTAGCCCCAGCATCTGG + Intergenic
1163123836 19:15233460-15233482 GGGCCTGTTGGGCCAGCAGGAGG - Intergenic
1163523843 19:17808287-17808309 GTGCCTCCAGCTCCAGCAGCCGG - Exonic
1164840665 19:31390085-31390107 GGGCATCTGGCCACAGCAGCAGG + Intergenic
1165195547 19:34099916-34099938 GGGCCTCTTGGAAGAGGAGCTGG - Intergenic
1165475264 19:36026706-36026728 GCGCCTCTCGCAGCAGCTGCTGG - Exonic
1167096992 19:47379868-47379890 GGGCCTGGTGCGCCAGCTGCCGG - Exonic
1168259524 19:55185713-55185735 TGGCTTCTAGCACCAGGAGCGGG + Intronic
1168475221 19:56670255-56670277 GGGGCTCTGGTACCAGGAGCTGG + Intronic
925439845 2:3875978-3876000 GGACAGCTAGCACCAGCAGCTGG - Intergenic
925739672 2:6994786-6994808 GGGCCTCTTCCAAGGGCAGCTGG - Intronic
926050414 2:9740868-9740890 GGACCTCTTACACCAGCTACTGG + Intergenic
926105295 2:10146073-10146095 GGGCACCCTGCACCAGCAGAAGG + Intronic
927151911 2:20201092-20201114 GGGCCTCTGGCCTCTGCAGCCGG + Exonic
927576180 2:24203688-24203710 GGACCTCATGCAGCAGCAGTCGG + Exonic
932448443 2:71794765-71794787 GGGCCCCTTGCACCCGCACCAGG - Intergenic
932599201 2:73112504-73112526 CGGCCTCCTGCGCCCGCAGCAGG + Exonic
932817699 2:74874898-74874920 GGGCCTCCTGCTGCAGCTGCAGG + Intronic
932848004 2:75154775-75154797 GGGACTCTTCCAACAGCAGCAGG - Intronic
934458099 2:94192303-94192325 GGGCACGTTGCAGCAGCAGCTGG - Intergenic
934640470 2:96024544-96024566 GGGCCACGTGCGCCCGCAGCAGG + Exonic
936055940 2:109262042-109262064 GGGGCTGGTGCATCAGCAGCCGG - Intronic
936373859 2:111924579-111924601 GGGATTCTGGCACCAGCAACTGG - Intronic
939855090 2:147349073-147349095 AGGCCTCTGGCAGCGGCAGCTGG + Intergenic
940902383 2:159137588-159137610 AGGCCTCATGTACCAGCAGTTGG - Intronic
941739434 2:169017638-169017660 GGGCCTATAGCACTAGCACCTGG - Intronic
944977328 2:205069761-205069783 GGCTCCCTGGCACCAGCAGCAGG + Intronic
946581855 2:221137610-221137632 CCGCCTCTTCCACCAGCTGCTGG + Intergenic
948567309 2:238895386-238895408 GGCCCTCCAGCACCACCAGCTGG + Intronic
948827031 2:240577826-240577848 GGGCCTCGTCCCCAAGCAGCAGG - Exonic
948983536 2:241507275-241507297 AGCCCTTTGGCACCAGCAGCTGG + Intronic
1168973878 20:1949691-1949713 GGGCCTCTTTTTCCAGCAGGAGG + Intergenic
1172664757 20:36591311-36591333 GCGCCACCTCCACCAGCAGCTGG - Exonic
1174490770 20:50893410-50893432 GGGCCTGTGGCAGCTGCAGCAGG + Exonic
1175056863 20:56206553-56206575 TGGCCTCTGGAACAAGCAGCAGG - Intergenic
1175265938 20:57703554-57703576 GGGCCTCTTGGGCCAGCAACGGG + Intronic
1175423954 20:58852804-58852826 GGGCCCCTGGCGCCAGGAGCAGG + Exonic
1175983850 20:62754623-62754645 GGGACTCATGCACCCTCAGCTGG - Intronic
1176279243 20:64291266-64291288 AGGTCTCTTGCACCAGAAGGTGG + Intergenic
1176412736 21:6457772-6457794 TGGCATCTTGCACCCGCTGCCGG - Intergenic
1179260163 21:39750884-39750906 GGTCCTCTTCCACCAGCTGGAGG - Intronic
1179688230 21:43066094-43066116 TGGCATCTTGCACCCGCTGCCGG - Intronic
1179905226 21:44419107-44419129 GGGCCTAATGGCCCAGCAGCGGG + Intronic
1180859759 22:19071063-19071085 GGGCCTCTTCCACCTCCACCAGG + Intronic
1181043193 22:20202620-20202642 CGGCCTCCTGCACCAGCAGATGG + Intergenic
1181358111 22:22314124-22314146 GGGCACGTTGCAGCAGCAGCTGG + Intergenic
1182304679 22:29359668-29359690 AGGCCTCTTCCTCCAGCAGAGGG - Intronic
1183345147 22:37303393-37303415 GCGCCTCTCTCACCCGCAGCTGG - Exonic
1184451526 22:44585625-44585647 GGGGCCCATGCTCCAGCAGCAGG + Intergenic
1185049810 22:48548109-48548131 GGGCCTCCTGCGCCTGAAGCTGG - Intronic
1185340305 22:50288010-50288032 GGCACTCCTGCACCGGCAGCCGG + Exonic
952109799 3:30109237-30109259 TAGCCTCTTGCACCTGCACCTGG - Intergenic
953464369 3:43105933-43105955 GGGCCTCCTGGGCCAGAAGCTGG - Exonic
954146176 3:48635423-48635445 CGGCCTCTAGCTCGAGCAGCAGG - Exonic
958168933 3:89914713-89914735 CAGCCTCTTGCACCTGCACCTGG + Intergenic
962422097 3:135237880-135237902 GCTCCTCATGCAGCAGCAGCAGG + Intronic
963200124 3:142578344-142578366 GGGACTCTTCCTCCAGCTGCAGG + Intronic
966914145 3:184575658-184575680 GGGCCTTTTGTAGCTGCAGCTGG + Intronic
968085309 3:195871472-195871494 AGGACTCTGGCACCACCAGCAGG + Intronic
968371416 3:198224576-198224598 AGGTCTCTTGCACCAGAAGGTGG + Intergenic
968526275 4:1059162-1059184 GGGCCTCCTGCCCCACAAGCCGG - Intronic
968589163 4:1449130-1449152 GTGCCTCACGCCCCAGCAGCAGG - Intergenic
968593931 4:1472905-1472927 TGCCCTCTTGCTCCAGGAGCTGG - Intergenic
969577905 4:8047124-8047146 GGGCCACGTGCAGCAGCAGGAGG + Intronic
970407658 4:15778811-15778833 GGGCCGCTTTCAGGAGCAGCTGG + Intronic
972842030 4:42942630-42942652 GGGCTTCTTACTCCAGCAACAGG + Intronic
975814703 4:78205715-78205737 GGGGCTCTGGGAGCAGCAGCAGG + Intronic
979328274 4:119403579-119403601 AGGTCTCTTGCACCAGAAGGTGG - Intergenic
985745107 5:1642434-1642456 GGGCCTCTTTTATGAGCAGCCGG + Intergenic
985992234 5:3572866-3572888 GGGGCTGGTGCACCAGCAGCAGG - Intergenic
986063786 5:4216279-4216301 GGTCCTTGTGCACAAGCAGCAGG + Intergenic
986211006 5:5672152-5672174 GGGCCCCTTTCACATGCAGCTGG - Intergenic
988829786 5:34976387-34976409 GGACTTGTTGCCCCAGCAGCAGG - Intergenic
989269314 5:39513389-39513411 AGGCCTATTGTTCCAGCAGCTGG - Intergenic
990694480 5:58400578-58400600 GGGCTTCTTCCTCCAGCTGCGGG + Intergenic
990694566 5:58401589-58401611 GGGCTTCTTCCTCCAGCTGCGGG + Intergenic
990801191 5:59605750-59605772 GGGTCACTTTCACCAGAAGCAGG + Intronic
994411951 5:99417821-99417843 GGGCAGCTTGCACCAGCTGCTGG - Intergenic
994481871 5:100347443-100347465 CGGCAGCTTGCACCAGCTGCTGG + Intergenic
995650390 5:114362292-114362314 GCACCTCGCGCACCAGCAGCCGG + Exonic
998260981 5:140631870-140631892 GGGCCCCTTGGAGCAGCACCAGG + Exonic
998463029 5:142323528-142323550 CTGCCTCTTTCACCAGCTGCTGG - Intronic
999716662 5:154366575-154366597 GGGCCTATTGTCTCAGCAGCTGG - Intronic
1002172400 5:177382766-177382788 CGGCCTCTGGCACGAGCAGTTGG - Intronic
1002730654 5:181330122-181330144 AGGTCTCTTGCACCAGAAGGTGG + Intergenic
1002753876 6:143982-144004 AGGTCTCTTGCACCAGAAGGTGG - Intergenic
1007489808 6:42211069-42211091 GGGCCTCGTTCAACAGCAGAAGG + Intronic
1007496565 6:42263733-42263755 CAGCCTCTTCCACCATCAGCTGG - Intronic
1008294606 6:49760528-49760550 GGGCCACTTACACCAGAGGCAGG - Intergenic
1013519994 6:110924189-110924211 GGGGCTGTTGCAGCAGCACCAGG - Intergenic
1014244967 6:119058313-119058335 GAGCCTCTTGCCTCAGTAGCTGG + Intronic
1015238077 6:130993677-130993699 AGGTCACTTGCGCCAGCAGCCGG - Intronic
1016116366 6:140290666-140290688 TGGCCCCCTGCAACAGCAGCAGG - Intergenic
1016171510 6:141024011-141024033 GGGCCTACTGCCCCAGCTGCTGG + Intergenic
1016876473 6:148870547-148870569 GGGCACCATGCACCTGCAGCAGG - Intronic
1017470347 6:154733023-154733045 GGTCCTTTTGCACAAGCGGCAGG - Intergenic
1019176054 6:170160087-170160109 GGGCCTCGGGCAGCACCAGCAGG + Intergenic
1019219895 6:170464860-170464882 GGGCCCCCTCCACCACCAGCAGG - Intergenic
1019357394 7:587754-587776 GGGCCTCCTGCCCCAGCAGCTGG - Intronic
1019713276 7:2526976-2526998 GGGCCTCGTGGAGCTGCAGCAGG + Intronic
1019962189 7:4470051-4470073 GCGCCTCTGTCAGCAGCAGCTGG + Intergenic
1021218990 7:17952522-17952544 AGGCCACTTGCACCAACAGTTGG + Intergenic
1022788284 7:33660702-33660724 CGGCCTCTCCCACCTGCAGCAGG - Intergenic
1023989081 7:45117451-45117473 GGGTCTTTTGCACCCCCAGCAGG + Intergenic
1024021447 7:45374303-45374325 TGGCCTCTTTCAGCAACAGCTGG + Intergenic
1024075798 7:45817295-45817317 AGGTCTCTTGCACCAGAAGGTGG + Intergenic
1025051640 7:55738499-55738521 AGGTCTCTTGCACCAGAAGGTGG - Intergenic
1025128603 7:56364166-56364188 AGGTCTCTTGCACCAGAAGGTGG - Intergenic
1025176983 7:56807049-56807071 AGGTCTCTTGCACCAGAAGGTGG - Intergenic
1025694809 7:63769337-63769359 AGGTCTCTTGCACCAGAAGGTGG + Intergenic
1025970025 7:66314386-66314408 GTGCCTCTTGTCCCAGCTGCAGG + Intronic
1026955943 7:74376543-74376565 GGGCCTCCTGCAGCTCCAGCCGG - Exonic
1027257137 7:76438223-76438245 TGGCCCCTAGCCCCAGCAGCAGG + Intronic
1027281714 7:76613819-76613841 TGGCCCCTAGCCCCAGCAGCAGG - Intronic
1029524789 7:101088038-101088060 GGGCCGCCTGCTCCCGCAGCCGG - Exonic
1030270249 7:107661921-107661943 GGGCCTCTGGGAGAAGCAGCTGG - Intronic
1031221946 7:118977781-118977803 GGGCTTATTGTACCAGCTGCTGG + Intergenic
1032020573 7:128405426-128405448 GGGCGTCCTGGACCAGCGGCTGG + Intronic
1032052330 7:128657042-128657064 AGGTCTCTTGCACCAGAAGGTGG + Intergenic
1032804373 7:135340189-135340211 GGGCATCTTGCCCCAGCTCCAGG - Intergenic
1034120719 7:148625059-148625081 GGACCTCTTCCTCCACCAGCAGG + Intergenic
1035114863 7:156516129-156516151 GGACCTTTGGCACCAGCAGGAGG + Intergenic
1035846940 8:2875276-2875298 GGGCATCTTGGACCAGGAGGAGG - Intergenic
1038000156 8:23384516-23384538 GAGCCTCCTGAACCAGCTGCAGG - Intronic
1038535319 8:28349314-28349336 AGGCCTTCTGCACCAGGAGCTGG - Intronic
1039522410 8:38182110-38182132 GTCCCTCTTGCCCCAGCATCTGG - Intronic
1043077530 8:75720418-75720440 CAGCCTCTTGCACCCGCACCTGG - Intergenic
1045553973 8:103197268-103197290 CTGGCTCTGGCACCAGCAGCAGG + Intronic
1049682036 8:143923586-143923608 CGGCCTCTTCCACCTGCCGCCGG + Exonic
1049783660 8:144440338-144440360 TGGGCTCTCGCACCTGCAGCTGG + Exonic
1049944680 9:582099-582121 GCGCCTCTTGCACCACCTGGCGG - Intronic
1053688610 9:40568108-40568130 GGGCACGTTGCAGCAGCAGCTGG - Intergenic
1054275423 9:63062949-63062971 GGGCACGTTGCAGCAGCAGCTGG + Intergenic
1054299850 9:63369019-63369041 GGGCACGTTGCAGCAGCAGCTGG - Intergenic
1054399410 9:64701982-64702004 GGGCACGTTGCAGCAGCAGCTGG - Intergenic
1054432988 9:65186247-65186269 GGGCACGTTGCAGCAGCAGCTGG - Intergenic
1054497395 9:65835428-65835450 GGGCACGTTGCAGCAGCAGCTGG + Intergenic
1057196816 9:93120068-93120090 TGGCCTCACACACCAGCAGCCGG - Intergenic
1057254743 9:93536363-93536385 GAGCCTGCTGCTCCAGCAGCTGG + Intronic
1059548008 9:115198315-115198337 AGGGCTCATACACCAGCAGCCGG + Intronic
1060526015 9:124321761-124321783 AGGCCTCCAGCAACAGCAGCTGG - Intronic
1060817357 9:126642169-126642191 GGCCCTGTTGTAGCAGCAGCAGG - Intronic
1060934757 9:127508487-127508509 GACCCTCCTGCACCAGGAGCTGG - Exonic
1061381904 9:130263937-130263959 GGACCTCTTTCTCCAACAGCTGG + Intergenic
1061587331 9:131577449-131577471 AGGCCTCTCACTCCAGCAGCAGG - Exonic
1062087381 9:134655836-134655858 GAGCCTCTGGCACCTGCAGCAGG + Intronic
1062355430 9:136159871-136159893 AGGCCTCTGACACCTGCAGCAGG - Intergenic
1062755063 9:138282632-138282654 AGGTCTCTTGCACCAGAAGGTGG + Intergenic
1203578971 Un_KI270745v1:26801-26823 AGGTCTCTTGCACCAGAAGGTGG + Intergenic
1185557327 X:1031725-1031747 GGGCCTGGTCCACCAGCAGCAGG + Intergenic
1187921205 X:24203609-24203631 GGGCCTCATGCACAGGCAGAAGG - Intronic
1189915437 X:45851405-45851427 GCGCCTCTTCCTCCTGCAGCTGG - Intergenic
1191178782 X:57537194-57537216 GCACCTGTTGCAGCAGCAGCTGG + Intergenic
1192077960 X:68019007-68019029 GGGGCTCTATCACCAGCAGGTGG - Intergenic
1192590389 X:72354927-72354949 GGGCCTCTTGCCCCAGGAGAAGG - Intronic
1198719652 X:139602609-139602631 GGGCCTACTGTACTAGCAGCTGG + Intronic
1198841854 X:140865549-140865571 CAGGATCTTGCACCAGCAGCAGG - Intergenic
1200000052 X:153055802-153055824 GGGCCTCAGGTCCCAGCAGCGGG + Intergenic
1200068528 X:153516790-153516812 AGGCCTCTTGCACCTGCCTCAGG + Intergenic
1200073785 X:153541444-153541466 GGGCCTCCCACACCAGCTGCAGG - Exonic
1200215561 X:154366703-154366725 GGGCCTCTGCTGCCAGCAGCTGG + Intronic
1202381595 Y:24279419-24279441 AGGTCTCTTGCACCAGAAGGTGG + Intergenic
1202489190 Y:25390707-25390729 AGGTCTCTTGCACCAGAAGGTGG - Intergenic