ID: 1083224073

View in Genome Browser
Species Human (GRCh38)
Location 11:61273667-61273689
Sequence TGCCCCTGACTCAGTCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 283}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083224073_1083224075 0 Left 1083224073 11:61273667-61273689 CCTTCAGGACTGAGTCAGGGGCA 0: 1
1: 0
2: 0
3: 23
4: 283
Right 1083224075 11:61273690-61273712 GAGGCTGTCAGTGCCCACCCAGG 0: 1
1: 0
2: 3
3: 32
4: 274
1083224073_1083224081 26 Left 1083224073 11:61273667-61273689 CCTTCAGGACTGAGTCAGGGGCA 0: 1
1: 0
2: 0
3: 23
4: 283
Right 1083224081 11:61273716-61273738 TGTCTCCGAAGTACTGCCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083224073 Original CRISPR TGCCCCTGACTCAGTCCTGA AGG (reversed) Intronic
901076445 1:6557898-6557920 TGTCCCTGGCTCATTCCTGGTGG + Intronic
901139691 1:7020657-7020679 TGCCTCTGATTCAGTGCTGGGGG + Intronic
903949982 1:26991118-26991140 TTCCCCTGAATCAGTCCTTGAGG + Intergenic
904418149 1:30375263-30375285 TGTCTCTGACTCTGCCCTGATGG - Intergenic
905172045 1:36115209-36115231 TGCCCCTGCCTGAGGCCTGGGGG - Intronic
907686085 1:56613078-56613100 TGCCCATGTCTGTGTCCTGAAGG - Intronic
909456647 1:75857359-75857381 TGCCCATGCCTATGTCCTGATGG + Intronic
911362555 1:96897137-96897159 TGCCCATGCCTATGTCCTGAAGG + Intergenic
911468602 1:98286433-98286455 TGCCCATGCCTATGTCCTGAAGG - Intergenic
912723907 1:112042534-112042556 TGCCCCTCACCCACTTCTGATGG + Intergenic
914682992 1:149953118-149953140 TGCCCATGCCTATGTCCTGAAGG + Intronic
914901701 1:151714632-151714654 TGCCCGGGATTCAGCCCTGAAGG - Exonic
917921447 1:179754157-179754179 TTTCCATGACTCAGTGCTGAAGG + Intronic
919063465 1:192664030-192664052 TGCCCATGACTATGTCCTGAAGG + Intergenic
922929722 1:229379655-229379677 TGCCTCTGTCTCAGACATGAGGG + Intergenic
923060788 1:230471705-230471727 TGCCCATGCCTGTGTCCTGAAGG + Intergenic
923875935 1:238047221-238047243 TGCCCATGCCTATGTCCTGATGG + Intergenic
924468602 1:244319871-244319893 AGGCCCTGACTCAGTGCAGAAGG + Intergenic
1062941699 10:1426759-1426781 TGCCCCTGGTTGACTCCTGACGG + Intronic
1063163004 10:3433464-3433486 TTCCCCTGTCTCATTCTTGAGGG - Intergenic
1063196695 10:3750017-3750039 TGGCCCTGACACAGTCCTTGGGG + Intergenic
1064059151 10:12122795-12122817 TTCACCTGACTCAGTGCTGGGGG + Exonic
1064293547 10:14057003-14057025 TGCCACTGACTCAGGCTTCAAGG - Intronic
1064977700 10:21135769-21135791 TGTCCCAGCCTCAGTGCTGAAGG + Intronic
1067179250 10:43972373-43972395 AGCCCCTGTCACAGACCTGAGGG + Intergenic
1067290385 10:44935439-44935461 TGCCATTGACTCAGCCCAGAAGG + Exonic
1067570787 10:47369409-47369431 TGGCCCTGGCTGAGTGCTGAGGG + Intronic
1068099766 10:52537708-52537730 TGCCCATGCCTATGTCCTGAAGG + Intergenic
1068584543 10:58782483-58782505 TGCCAGTTACTGAGTCCTGAAGG + Intronic
1070776263 10:79111556-79111578 TTCCCTTGGCTCAGGCCTGAGGG - Intronic
1072069412 10:91901968-91901990 TGCCTGTGACTCATGCCTGAAGG + Intergenic
1073284431 10:102379189-102379211 TGTCCCTAACTAAGTCCTCAAGG - Intronic
1076693806 10:132237405-132237427 TCCTCCTGAATCAGTCATGAGGG + Intronic
1076772042 10:132671118-132671140 TGCCCATGCCTCACTCCAGAAGG - Intronic
1077468532 11:2745787-2745809 GGCCCCGGGCTCAGGCCTGAAGG - Intronic
1077660700 11:4066063-4066085 TTCCCTTGTCTCAGGCCTGATGG + Intronic
1079089751 11:17472600-17472622 TGCCCCTCACTCAGGCCTGGGGG + Intronic
1080622202 11:33996286-33996308 TGCCCCTAACTCCCTACTGAAGG - Intergenic
1080965170 11:37206151-37206173 TGCCCATGCCTGTGTCCTGAAGG + Intergenic
1081759981 11:45570406-45570428 TGGCCCAGAGTCAGCCCTGATGG + Intergenic
1083224073 11:61273667-61273689 TGCCCCTGACTCAGTCCTGAAGG - Intronic
1083870935 11:65488144-65488166 TGCCCCTTTCTCAGGCCTGTGGG - Intergenic
1084192726 11:67506110-67506132 AGCCTCTGAATCAGCCCTGAAGG - Intronic
1084425107 11:69080203-69080225 TGCCCCTGGCTCAGGTCTCAGGG + Intronic
1084548248 11:69825249-69825271 TGGCTCTGACTCAGACCTGGTGG + Intergenic
1084681498 11:70669058-70669080 TGACCCTGAGTCATTCCAGAAGG - Intronic
1084715785 11:70872605-70872627 TGCCCCTGACTCTGGTCTGTGGG - Intronic
1085206346 11:74734808-74734830 TGCCCCTCACTCTGTCCCCAGGG + Intergenic
1085256461 11:75176284-75176306 AGCCCCTGACCCAGTCCCAAGGG - Intronic
1086757106 11:90578536-90578558 TGCCCATGCCTATGTCCTGAAGG + Intergenic
1088150416 11:106738462-106738484 TGCCCATGCCTATGTCCTGAAGG + Intronic
1089848062 11:121473997-121474019 TGCTCCCCAGTCAGTCCTGAGGG - Intronic
1091599356 12:1908599-1908621 TGTCCGTGACGCAGTCCTGGGGG - Intronic
1095658731 12:44702730-44702752 TGCTACTGATTCAGTCCTAAAGG - Intronic
1096550934 12:52371093-52371115 TCCCCCTCAGTCAGTCCTGATGG + Intergenic
1098442980 12:70537328-70537350 AGGCCCTGCCTCAGCCCTGATGG + Intronic
1099406822 12:82273933-82273955 TGCCCATGCCTATGTCCTGAAGG + Intronic
1100186935 12:92148763-92148785 TGCCTCTGGCTCAGTCTGGAAGG - Intergenic
1101629635 12:106480470-106480492 TGCCCCTGCCTGACTCCTGGAGG - Intronic
1102593163 12:113972811-113972833 TGCCCCTGGATTAGTTCTGATGG - Intergenic
1103513292 12:121490002-121490024 TGCCCCGCTCTCAGTCCTGTCGG - Intronic
1104844689 12:131840872-131840894 GGCTCCTGACTCTGCCCTGAGGG - Intronic
1106541765 13:30696897-30696919 TACTCGTGAGTCAGTCCTGAAGG + Intergenic
1107194924 13:37639179-37639201 TCCTCCTGAGTCAGTTCTGAAGG + Intronic
1110479656 13:75959533-75959555 TTCCCCTGACTCAGCTCCGAGGG - Intergenic
1112118996 13:96388812-96388834 TGGCACTCACTCTGTCCTGAAGG + Intronic
1112619684 13:101042023-101042045 TGCCCATGCCTATGTCCTGAGGG + Intergenic
1114621606 14:24099407-24099429 TGCCACTAACCCAGGCCTGATGG + Intronic
1114994529 14:28331482-28331504 TGCCCATGCCTATGTCCTGATGG - Intergenic
1119131961 14:72181238-72181260 TGCTCCTTACTGAGTCATGAAGG - Intronic
1119264449 14:73255711-73255733 TGGCCTTGACTCACTCGTGATGG + Intronic
1119379800 14:74221287-74221309 AGCCGCTGACTCAGGCCTCAGGG + Intergenic
1121022421 14:90588482-90588504 AGACCCTGGCTCAGTGCTGAAGG + Intronic
1121266827 14:92609285-92609307 TGCCCCTGACACAGCCTTGAGGG + Intronic
1202829700 14_GL000009v2_random:14047-14069 TGCCCCTGACCCAGCCCACATGG - Intergenic
1125475782 15:40047330-40047352 TGCCCTTGGCTAAGTCATGAGGG - Intergenic
1126357027 15:47807008-47807030 TTCTCCTGCCTCAGCCCTGAAGG - Intergenic
1129133063 15:73518297-73518319 AGCCCCTGACTCAGTTGTGCTGG - Intronic
1129588427 15:76892243-76892265 TGCCCATGCCTATGTCCTGAAGG - Intronic
1129883889 15:79025523-79025545 TGCCTCTGACCCAGCCTTGAAGG + Intronic
1132758827 16:1499209-1499231 GGCCCCTGACTCTGTCTTGCAGG + Exonic
1132810971 16:1796951-1796973 TGCGCCTGGCTGAGACCTGATGG + Intronic
1132869784 16:2110786-2110808 TGCCAATGACTCAGCCCTGGTGG - Exonic
1132977123 16:2716440-2716462 TGTCCCTGGCTCAGTCCAGCCGG + Intronic
1133018486 16:2955643-2955665 TCCCCCTGCCTCAGGCCTGCAGG - Intergenic
1134717637 16:16364815-16364837 TGCCAATGACTCAGCCCTGGTGG + Intergenic
1134905726 16:17978007-17978029 TGCCACAGACTCTGTCTTGAGGG - Intergenic
1134957115 16:18387344-18387366 TGCCAATGACTCAGCCCTGGTGG - Intergenic
1135910885 16:26559571-26559593 TGTTCTTGATTCAGTCCTGAGGG - Intergenic
1136091177 16:27921119-27921141 TGCTCCCCACTCAGGCCTGATGG + Intronic
1136569989 16:31090926-31090948 TGCCTCTGACTCTGTCCCCATGG - Exonic
1137374667 16:47942239-47942261 TGCTCCAGGCTCAGTCCTCATGG - Intergenic
1138862037 16:60770314-60770336 TTCTCCTGACTCAGTGCTCAGGG + Intergenic
1138862042 16:60770361-60770383 TTCTCCTGACTCAGTGCTCAGGG + Intergenic
1138862047 16:60770408-60770430 TTCTCCTGACTCAGTGCTCAGGG + Intergenic
1138862057 16:60770549-60770571 TTCTCCTGACTCAGTGCTCAAGG + Intergenic
1139155142 16:64432563-64432585 TGCCCATGCCTGTGTCCTGAAGG + Intergenic
1139673551 16:68508193-68508215 AGCCCATGACTCACTCCTTAAGG + Intergenic
1140653610 16:77116388-77116410 TGCCCATGCCTATGTCCTGAAGG - Intergenic
1140908337 16:79429150-79429172 TGTTCCTGAGTCAGTCCTCAAGG - Intergenic
1141676862 16:85522299-85522321 TATACCTGACCCAGTCCTGACGG - Intergenic
1141802243 16:86317915-86317937 TCCCACTGACTCCGTCCTGCTGG - Intergenic
1142497373 17:313464-313486 TTCCCCTGGAACAGTCCTGAAGG - Intronic
1143171781 17:4934486-4934508 CGACCCTGACTCAGAGCTGAGGG - Exonic
1144452475 17:15392456-15392478 GGCTCCTGACTCAGTCCTTTAGG + Intergenic
1144794356 17:17881093-17881115 TGTCCCTGTCTCTGTGCTGAGGG - Intronic
1145971138 17:28957117-28957139 TGCCCCTGGCTATGTGCTGAAGG - Exonic
1151996696 17:77613924-77613946 TGCCCCTGGCTCAGACCAGGAGG + Intergenic
1152134081 17:78493891-78493913 GGCCCATGACTCAGGCCGGAGGG + Intronic
1152336504 17:79702265-79702287 TGCCCCTGCCTCGGGCCTGCAGG - Intergenic
1156798273 18:41075514-41075536 TGTCTCTGACTCAGTCCTTTTGG - Intergenic
1157431784 18:47634247-47634269 AGCCCCTGCCCCTGTCCTGAAGG - Intergenic
1157528735 18:48405013-48405035 AGCCCCTGAGACAGTTCTGATGG + Intronic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1160356494 18:78231477-78231499 TGAGCCTGTCTCAGCCCTGATGG - Intergenic
1160716898 19:580819-580841 GGCCTCTCACCCAGTCCTGAGGG - Intronic
1160716916 19:580865-580887 GGCCCCTCACCCAGTCCTGAGGG - Intronic
1160716934 19:580911-580933 GGCCCCTCACCCAGTCCTGAGGG - Intronic
1160716952 19:580957-580979 GGCCCCTCACCCAGTCCGGAGGG - Intronic
1160716971 19:581003-581025 GGCCCCTCACCCAGTCCGGAGGG - Intronic
1160717011 19:581110-581132 GGCCCCTCACCCAGTCCTGAGGG - Intronic
1160717029 19:581156-581178 GGCCCCTCACCCAGTCCGGAGGG - Intronic
1160717046 19:581202-581224 GGCCCCTCACCCAGTCCGGAGGG - Intronic
1160717063 19:581248-581270 GGCCCCTCACCCAGTCCTGAGGG - Intronic
1164903486 19:31947846-31947868 TCCTCCTGACTCAGTCCGCAGGG - Intergenic
1165193902 19:34086333-34086355 AGCCCCAGTCTCAGTCCTGCAGG + Intergenic
1167049805 19:47071450-47071472 GGCCACTAACTGAGTCCTGATGG + Intronic
1167587568 19:50383661-50383683 TGCCCCTGTGCCAGCCCTGAAGG + Intergenic
1168720602 19:58552697-58552719 GGCCCCAGGCTCACTCCTGAGGG + Intronic
1202642992 1_KI270706v1_random:113738-113760 TGCCCCTGACCCAGCCCACATGG + Intergenic
925822746 2:7816344-7816366 TGCCCCTGACTCTGTGTTCAAGG - Intergenic
925874473 2:8300290-8300312 TGCCCCTCACACAGACCTGGTGG - Intergenic
926615935 2:14996526-14996548 TGCCCATGTCTCAGCCCAGAGGG + Intergenic
927826278 2:26312115-26312137 TGCCCCCGGCTCAGTCCTGTGGG - Intronic
928061034 2:28113273-28113295 TGCCCATGCCTGTGTCCTGATGG + Intronic
930403781 2:50927980-50928002 GGTCACTGATTCAGTCCTGACGG + Intronic
931307049 2:61039662-61039684 TGCCCATGCCTATGTCCTGAAGG - Intronic
931981566 2:67698718-67698740 TGCCCATGCCTATGTCCTGAAGG - Intergenic
932908296 2:75778304-75778326 TGCCCGTGCCTGTGTCCTGAAGG - Intergenic
934158760 2:89228244-89228266 TGCCCCTTACTGAGGCCTCATGG + Intergenic
934208515 2:89954184-89954206 TGCCCCTTACTGAGGCCTCATGG - Intergenic
934498864 2:94837215-94837237 TGCCCCTGACCCAGCCCACATGG + Intergenic
934636691 2:95995855-95995877 TGGCTCTGACTCACACCTGAAGG + Intergenic
934796959 2:97109569-97109591 TGGCTCTGACTCACACCTGAAGG - Intergenic
934836455 2:97593858-97593880 TGGCTCTGACTCACACCTGAAGG + Intergenic
936151639 2:110025189-110025211 TGCCCCTGGCTCTGACCTAAAGG + Intergenic
936193035 2:110346180-110346202 TGCCCCTGGCTCTGACCTAAAGG - Intergenic
936573583 2:113635590-113635612 TGCCCGGGACGCAGTCCTCACGG + Intronic
937507704 2:122555733-122555755 TGCCCATGCCTATGTCCTGAAGG - Intergenic
940080112 2:149791693-149791715 TGCCCATGCCTATGTCCTGAAGG + Intergenic
940085636 2:149855380-149855402 TGCCCATGCCTATGTCCTGAAGG - Intergenic
943872063 2:193012134-193012156 TGCCCCTAACTCCTCCCTGAAGG + Intergenic
944580577 2:201129170-201129192 AGCCCCTCACTCACACCTGAGGG - Intronic
944632746 2:201643380-201643402 AGCCCCCGAGTCAGTCCTCATGG + Exonic
944908063 2:204282510-204282532 TCTCCCTGACTCAGTTCTGGGGG - Intergenic
946181884 2:217953814-217953836 TGCTCCTGACACAGGCCAGACGG - Intronic
947191511 2:227510790-227510812 TGCCCTTTACTAAGTCCTTATGG + Intronic
948380478 2:237547082-237547104 TGGCCCTTACTCAGGACTGACGG - Intronic
948897777 2:240935237-240935259 TGCCCCTGGGCCAGGCCTGAGGG + Intronic
1168875472 20:1169210-1169232 TGGCCCTGAATCTGTCCTGGAGG + Intronic
1171890115 20:30703940-30703962 TGCCCCTGACCCAGCCCACATGG + Intergenic
1172049965 20:32109855-32109877 GACCCCTGACTCAGGCCTGAGGG + Intronic
1174132618 20:48356630-48356652 TGGCCCTGCCTCAGCCCTAAGGG + Intergenic
1174205005 20:48831809-48831831 GGCCCCTGGCTGAATCCTGATGG - Intergenic
1175536466 20:59718147-59718169 TGCCCAGGACTCAGGCCTGGGGG - Intronic
1175630103 20:60528528-60528550 TCCTCCAGATTCAGTCCTGATGG + Intergenic
1175813606 20:61872313-61872335 GCCCCATGACTCAGTCCAGAGGG + Intronic
1175889157 20:62308490-62308512 TGCCCCTGGCTCTGGCCTGGAGG - Intronic
1176088353 20:63308105-63308127 TGCCCCTCCCTCTGTCCTGAGGG + Intronic
1176608885 21:8858887-8858909 TGCCCCTGACCCAGCCCACATGG - Intergenic
1177092356 21:16784855-16784877 TGCCCATGCCTAAGTCCTGAAGG - Intergenic
1179484085 21:41698562-41698584 TGGCACTGACTCAATCCTGTGGG - Intergenic
1179501685 21:41813186-41813208 GGCACTTAACTCAGTCCTGAGGG + Intronic
1179551846 21:42148421-42148443 TTCTCCTGTCTCAGTTCTGATGG + Intergenic
1180358975 22:11868719-11868741 TGCCCCTGACCCAGCCCACATGG - Intergenic
1182067048 22:27438287-27438309 TGCCCCTGAAACAGTCCCCAGGG - Intergenic
1182692932 22:32176306-32176328 AGCCCCTGACCGAGTCCAGAGGG + Intergenic
1183110057 22:35642319-35642341 TGTCCCACACTCATTCCTGAAGG + Intergenic
1183255883 22:36761912-36761934 AGCCCATGACTCAATTCTGAGGG + Intronic
1183988834 22:41584496-41584518 TGCCCCTGGCTAAGCCCTGGGGG + Intronic
1185275482 22:49948770-49948792 TGCCCCTGACACACCCCCGATGG + Intergenic
1185426599 22:50775290-50775312 TGCCCAGGACGCAGTCCTCACGG - Intronic
950313940 3:11983911-11983933 TACCCCCGTCTCATTCCTGATGG + Intergenic
950360283 3:12445039-12445061 GGCTCCTGAGTCAGTCCTCAGGG + Intergenic
952746056 3:36781438-36781460 TGGCCCTGACTCAGAGCTTATGG - Intergenic
952986116 3:38785552-38785574 TGCCCATGCCTATGTCCTGAAGG - Intronic
953264892 3:41377293-41377315 TGCCCATGCCTATGTCCTGATGG - Intronic
956210671 3:66798428-66798450 CACCCATGACTGAGTCCTGACGG - Intergenic
959147925 3:102571988-102572010 TGACTGTGACTCACTCCTGAAGG - Intergenic
959829626 3:110844775-110844797 TGCCCATGCCTATGTCCTGAAGG - Intergenic
960140264 3:114145090-114145112 TTCCCCTGACTCATTCTTGGTGG - Intronic
960456208 3:117875599-117875621 TGTACCTGACTCAGACCAGATGG + Intergenic
961735979 3:129002400-129002422 TTCCTCTGACTCTGTCCTGTCGG - Intronic
962993411 3:140601163-140601185 AGCACCTGACTCAGTACTCAGGG + Intergenic
964262410 3:154854243-154854265 TGCCCATGCCTATGTCCTGAAGG + Intergenic
965039260 3:163485030-163485052 TGCCCATGCCTATGTCCTGAAGG - Intergenic
966885299 3:184374330-184374352 CTTCCCTGACTCAGTCCTGAAGG + Intronic
968875995 4:3268303-3268325 GGGCCCTGAGGCAGTCCTGAGGG + Intronic
969902553 4:10363192-10363214 TGACCAGGGCTCAGTCCTGATGG + Intergenic
970539885 4:17067136-17067158 TGGCCCTGACTCACTCCCTAAGG - Intergenic
973701604 4:53542851-53542873 TCCCCCTGATTTATTCCTGATGG - Intronic
973920637 4:55681564-55681586 TACCTGTGACTCAGTCCTGCTGG + Intergenic
974360756 4:60876160-60876182 TGCCCATGCCTGTGTCCTGAAGG + Intergenic
974498651 4:62667106-62667128 TGCCCATGCCTGTGTCCTGATGG - Intergenic
975508746 4:75169071-75169093 TGCATCTGAATCATTCCTGAAGG - Intergenic
975721458 4:77252665-77252687 TGCCCATGCCTATGTCCTGAAGG + Intronic
976716478 4:88127832-88127854 TGCCCATGCCTATGTCCTGAAGG - Intronic
976849247 4:89526516-89526538 TGCCCCTGCCTATGTCCTGAGGG - Intergenic
980196275 4:129592791-129592813 TGCCCATGCCTATGTCCTGAAGG - Intergenic
981065805 4:140484471-140484493 TGCCCATGCCTATGTCCTGAAGG - Intronic
981448239 4:144865826-144865848 TGCCCATGCCTATGTCCTGAAGG + Intergenic
982026715 4:151258866-151258888 TGCCCGTGTCTCTGTCCTGAGGG - Intronic
983023431 4:162707936-162707958 TGCTTCTGATTCAGTCTTGAGGG - Intergenic
983328648 4:166293761-166293783 TGCTACTGACTCATTCGTGATGG - Intergenic
983946262 4:173589091-173589113 TGCCCCTGCCTCTGTCATGGAGG + Intergenic
984514890 4:180725984-180726006 TTCCTCTAACTGAGTCCTGAGGG + Intergenic
984871405 4:184328604-184328626 TGTCCCATCCTCAGTCCTGAGGG + Intergenic
986355615 5:6922409-6922431 TGCCCATGCCTATGTCCTGATGG + Intergenic
988971255 5:36470357-36470379 TGCCCATGCCTGTGTCCTGAAGG - Intergenic
989397845 5:40977603-40977625 TGCCCCTGGCTCACGCCTGTGGG - Intronic
994264730 5:97701355-97701377 TGCCCATGCCTATGTCCTGAAGG + Intergenic
994322228 5:98407002-98407024 TGCCCTTGCCTCAGTACTCAAGG - Intergenic
994551101 5:101236339-101236361 TGCCCATGCCTATGTCCTGAAGG + Intergenic
995951574 5:117720654-117720676 TGCCCATGCCTGTGTCCTGAAGG - Intergenic
998203736 5:140145037-140145059 TGCCACTTTCACAGTCCTGAGGG - Intergenic
999964193 5:156790536-156790558 TGCCCATGCCTATGTCCTGATGG - Intergenic
1000611546 5:163380411-163380433 TGCCCATGCCTATGTCCTGATGG - Intergenic
1003694449 6:8389417-8389439 TGTCCCTGTCTCATTCCTGAGGG + Intergenic
1005378750 6:25212286-25212308 TGCCCATGCCTATGTCCTGAAGG - Intergenic
1005810672 6:29513174-29513196 TGCAGCTGACTCAGCCCTGAGGG + Intergenic
1005995767 6:30930485-30930507 TGCCACTGCCTGAATCCTGAAGG - Intergenic
1006127862 6:31851723-31851745 TGTACCTGACTCAGACCAGATGG + Intergenic
1006629298 6:35419850-35419872 AGCCTCTGACCCAGCCCTGATGG + Intronic
1007265109 6:40589867-40589889 TGACCCTAACTCAGTCCTTGTGG - Intergenic
1007342509 6:41200525-41200547 TGTCCCTGCCTCTGTCCTGAAGG - Intronic
1007655960 6:43451083-43451105 TTCTCCTGCCTCTGTCCTGAGGG - Exonic
1007873451 6:45067383-45067405 TGCCCATGCCTATGTCCTGAAGG - Intronic
1008329130 6:50224374-50224396 TGCCCATGCCTATGTCCTGAAGG + Intergenic
1009383161 6:63057132-63057154 TGCTCGTGCCTCTGTCCTGAAGG - Intergenic
1009660907 6:66609907-66609929 TGCCCATGCCTATGTCCTGATGG - Intergenic
1009916292 6:70000939-70000961 TGCCCATGCCTATGTCCTGAAGG + Intronic
1012822311 6:104101466-104101488 TGCCCATGCCTTTGTCCTGAAGG - Intergenic
1013140614 6:107330139-107330161 TGTCCCTGAATCACTCTTGAAGG - Intronic
1017341889 6:153333592-153333614 TGCCCCTCACTCAATTCTGGAGG - Intergenic
1017959486 6:159209418-159209440 TGCACCTGAGAGAGTCCTGATGG + Intronic
1018796273 6:167187715-167187737 AGCCCCTGACTAAGGTCTGACGG - Intronic
1018820046 6:167367343-167367365 AGCCCCTGACTGAGGTCTGACGG + Intronic
1019595670 7:1857286-1857308 AGCCTCTGACTCAGTGCTCAGGG + Intronic
1021865848 7:24956244-24956266 TGCCCCTGACTCAGCCTCAAAGG + Intronic
1022470855 7:30681306-30681328 AGCCCCTGACTCAGCCCAGCAGG + Intronic
1023767157 7:43522426-43522448 TCCCTCTGACTCAGTCCAGGAGG - Intronic
1025565621 7:62430419-62430441 TGCCCATGCCTATGTCCTGAAGG - Intergenic
1026044123 7:66893987-66894009 AGCCCCTGACTCCATCTTGAAGG - Intergenic
1029267147 7:99351508-99351530 TGCGCCTGGCCCAGTCCTGTGGG + Intronic
1029689762 7:102173558-102173580 AGCCGCTGACCCTGTCCTGAAGG - Intronic
1030939178 7:115623917-115623939 TGCCCCTGGCTCCATGCTGAGGG + Intergenic
1032309056 7:130765522-130765544 TGCCCATGCCTATGTCCTGATGG + Intergenic
1032836382 7:135679026-135679048 AGAACCTGACTCACTCCTGAAGG - Intronic
1033851857 7:145506117-145506139 TGCCCATGCCTACGTCCTGAAGG - Intergenic
1035272653 7:157729642-157729664 TGGTCCTGACCCAGTCCTGCAGG + Intronic
1036296777 8:7543696-7543718 TGCCCCTGGGTGAGTCCTGGAGG - Intergenic
1036325790 8:7777323-7777345 TGCCCCTGGGTGAGTCCTGGAGG + Intergenic
1038582305 8:28759173-28759195 TGCCCATGCCTATGTCCTGAAGG + Intergenic
1038852304 8:31291675-31291697 TGCCCATGACTATGTCCTGAAGG + Intergenic
1039658659 8:39438072-39438094 TGCCCATGCCTATGTCCTGAAGG - Intergenic
1039853590 8:41393720-41393742 AGCCCCCGAATCTGTCCTGAGGG - Intergenic
1041972158 8:63756153-63756175 TGCCCGTGCCTCTGTCCTGATGG + Intergenic
1042105197 8:65318774-65318796 TGTCCCTAACTCAGACCAGATGG + Intergenic
1043387349 8:79761478-79761500 TGCCCATGGCTCAGTCTTGCTGG + Intergenic
1045972331 8:108092921-108092943 TTCCCCTGACTGAATCATGATGG + Intergenic
1048925094 8:139264447-139264469 TGCCACTGTCCCTGTCCTGAGGG - Intergenic
1049187756 8:141267227-141267249 TGCCCCGGTATCATTCCTGAAGG - Intronic
1049747397 8:144268845-144268867 TGCCCCCGACTCGGGCCTGTCGG + Intronic
1050484900 9:6123811-6123833 TGCCTCTGCCTCAGTACTCAAGG + Intergenic
1051262036 9:15273876-15273898 AGTCCCTGCCTCAGTCCTGGGGG - Intronic
1051702490 9:19838810-19838832 TGCCCATGCCTATGTCCTGAAGG - Intergenic
1052833541 9:33234115-33234137 AACCCATGACTCAGACCTGATGG + Intronic
1054358989 9:64094276-64094298 TGCCCCTGACCCAGCCCACATGG - Intergenic
1054370419 9:64389615-64389637 TGCCCCTGACCCAGCCCACATGG - Intronic
1054678047 9:67879370-67879392 TGCCCCTGACCCAGCCCACATGG - Intronic
1054913961 9:70479058-70479080 TGTCCCTGACTAAGTCCTTGAGG + Intergenic
1055505406 9:76943202-76943224 TGCCCATGACTCCTTCCTGCAGG + Intergenic
1056877157 9:90344804-90344826 TGACCCTGACTGAGTCTTCAGGG + Intergenic
1057536295 9:95910846-95910868 TGCCACTGACTTAGTTGTGAAGG - Intronic
1059064515 9:111068957-111068979 TGCGCATGATTCAGTTCTGAAGG + Intergenic
1059155338 9:111984157-111984179 TGCCCCTGTCTCAGCCTTCAGGG - Intergenic
1061004262 9:127919525-127919547 TGGCGCTGACTCAGCCCTGTGGG + Intergenic
1061219737 9:129243219-129243241 TGCCCGTGCCTCCGTCCTCATGG - Intergenic
1061806985 9:133142179-133142201 TGCCCCTGGATCCTTCCTGAGGG - Intronic
1062186209 9:135220000-135220022 TGCCCCTCACCCAGGCCTGGCGG + Intergenic
1062397526 9:136358441-136358463 TGCCCCTGCCGCAGGCCGGACGG + Exonic
1062657530 9:137612012-137612034 TGGCCCTGACTCAGCCCTGCAGG + Intronic
1203704284 Un_KI270742v1:24112-24134 TGCCCCTGACCCAGCCCACATGG - Intergenic
1203559715 Un_KI270744v1:41710-41732 TGCCCCTGACCCAGCCCACATGG + Intergenic
1186810741 X:13186054-13186076 TGCCCATGCCTTAGTCCTGAAGG - Intergenic
1188248713 X:27864571-27864593 TGCCTCTGACTCTGTCCCCAAGG + Intergenic
1192195472 X:69025042-69025064 TGCCCCTGACTGGGCCCGGAAGG - Intergenic
1192210814 X:69126647-69126669 TGCCGCTAACAGAGTCCTGAAGG - Intergenic
1193381686 X:80823289-80823311 TGCCCATGCCTATGTCCTGAAGG + Intergenic
1193429613 X:81385417-81385439 TGCCCATGCCTTTGTCCTGAAGG + Intergenic
1194934202 X:99927900-99927922 TGCCCATGCCTATGTCCTGAGGG - Intergenic
1195978671 X:110555525-110555547 TGCCCATGCCTATGTCCTGATGG + Intergenic
1196163049 X:112506971-112506993 TGCCCATGCCTATGTCCTGAAGG - Intergenic
1197123830 X:122921449-122921471 TGCCCCTGGCTATGTCCTGATGG + Intergenic
1197485932 X:127051891-127051913 TGCCCATGCCTATGTCCTGAAGG + Intergenic
1200137732 X:153883166-153883188 TGCCCCTGCCTCACCCTTGAGGG - Intronic
1201970882 Y:19793441-19793463 TGCCCATGCCTATGTCCTGAAGG + Intergenic