ID: 1083224814

View in Genome Browser
Species Human (GRCh38)
Location 11:61278203-61278225
Sequence GTGTAAAACACGAAGGTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083224814 Original CRISPR GTGTAAAACACGAAGGTTGG TGG (reversed) Intronic
903614888 1:24644087-24644109 GAGTAAAACACGATGGTGGCGGG - Intronic
907732386 1:57079681-57079703 CTGTAAAACACCAAGGTGGTGGG - Intronic
908535199 1:65070046-65070068 GTGTAAAACAAGAGGTATGGAGG - Intergenic
911864992 1:103006900-103006922 ATGTAAAACCCCAAGGTTTGGGG - Intronic
916884968 1:169058446-169058468 GTGTATAACATGAAGTGTGGAGG + Intergenic
918761809 1:188420280-188420302 GTTTAAAGCTCAAAGGTTGGTGG - Intergenic
921310795 1:213841297-213841319 TTTTAAAACATGAAGATTGGAGG + Intergenic
1067205388 10:44208005-44208027 GTGTGAAACTCCAAGGCTGGAGG + Intergenic
1068135695 10:52949867-52949889 GTAAAAATCAGGAAGGTTGGTGG - Intergenic
1069812675 10:71174059-71174081 TTGTGAAACAGGAAGGCTGGAGG - Intergenic
1069816547 10:71199186-71199208 TTGTAAATCACTAAGTTTGGAGG + Intergenic
1073433315 10:103500848-103500870 CTGTTAAACACGCAGGTTTGAGG - Intronic
1073843010 10:107519794-107519816 GTGTCAAACATGGAGGCTGGGGG - Intergenic
1073926853 10:108526600-108526622 GTATAACACACTCAGGTTGGAGG - Intergenic
1074787400 10:116852965-116852987 GTTTAAACCACCAAGGTTTGGGG + Intronic
1082734280 11:56838958-56838980 GTGTAAACCACCAAGGCTTGGGG + Intergenic
1083224814 11:61278203-61278225 GTGTAAAACACGAAGGTTGGTGG - Intronic
1084485979 11:69448647-69448669 GTGAAAACCACAAGGGTTGGGGG - Intergenic
1085439722 11:76548548-76548570 GTGTAAAATAAGATAGTTGGAGG - Intronic
1085987117 11:81800869-81800891 GTGTAAGCCACCAAGGTTTGAGG - Intergenic
1091470255 12:720328-720350 GAGTAAAACAAGGAGGTTGTGGG - Intergenic
1093664584 12:21796012-21796034 GTGTAAAATAAGTAGCTTGGTGG - Intergenic
1098648792 12:72939392-72939414 GTGTAAGACACCAAGGCTTGTGG + Intergenic
1102078785 12:110081082-110081104 GTATTAAACACGAAGATAGGTGG + Intergenic
1105529728 13:21208543-21208565 TTTTAACACACGAATGTTGGAGG - Intergenic
1106414007 13:29530894-29530916 GTTTAAATCACCAAGGTTGTGGG + Intronic
1108881095 13:55116929-55116951 GTGTAAAACAGAAAGCCTGGTGG - Intergenic
1110882924 13:80595244-80595266 GTGTATAAAATGAAGTTTGGAGG + Intergenic
1111971344 13:94920075-94920097 ATGTAAAACACCAAGGATGCTGG + Intergenic
1117595755 14:57325612-57325634 GGATTAAACACGAAGGTTTGAGG + Intergenic
1118939879 14:70323827-70323849 AGGTAAAACAGGAAGGTTGGAGG + Intergenic
1127449015 15:59098718-59098740 GTGTAAACCACTAAGTTTTGGGG - Intergenic
1135935836 16:26779266-26779288 GTTTAAAAAAAGAAGGTGGGGGG + Intergenic
1136158802 16:28404008-28404030 ATTTAAAACACGAAGATCGGCGG + Intergenic
1136204286 16:28711275-28711297 ATTTAAAACACGAAGATCGGCGG - Intronic
1137005386 16:35270815-35270837 GTAAAAATCAGGAAGGTTGGTGG - Intergenic
1138130339 16:54473898-54473920 GTGTAAAAGACAAAGCATGGAGG + Intergenic
1139914799 16:70421351-70421373 GTGAGAAAAACGAAGGTTGGGGG + Intronic
1145837755 17:27967586-27967608 GTGTAACAAAAGAAGGTTGGGGG - Intergenic
1146470266 17:33118654-33118676 GTGCAAAATAAGAAGTTTGGAGG - Intronic
1151500554 17:74485641-74485663 GTTTAAAACACAGAGGTTCGTGG + Intergenic
1151885797 17:76922751-76922773 GGGGAAGACAGGAAGGTTGGAGG + Intronic
1156074875 18:33262369-33262391 ATGAAAAAAAGGAAGGTTGGAGG - Intronic
1160147490 18:76377014-76377036 GTGGAAAACAAGTTGGTTGGTGG - Intronic
1164053147 19:21600031-21600053 TTGGAAAACACAAAGGATGGGGG - Intergenic
1164063018 19:21691668-21691690 GTAAAAATCAGGAAGGTTGGTGG - Intergenic
1168586577 19:57598830-57598852 TGGTAAGACACGAAGGTGGGTGG - Intergenic
928124370 2:28605634-28605656 GGGTCAAAAAGGAAGGTTGGGGG + Intronic
929771029 2:44892124-44892146 GTGTAAACCACCAAGGCTTGGGG + Intergenic
932372313 2:71200814-71200836 CTGTAAAACATTAGGGTTGGGGG + Intronic
933097161 2:78200125-78200147 ATGTAAAACAAGTAGGTTGAAGG + Intergenic
937367179 2:121271880-121271902 GTGGAAAACAGGAGGGTTGGGGG + Intronic
937435755 2:121879769-121879791 GGGTAAGACAGGAAGGCTGGAGG + Intergenic
937799607 2:126066730-126066752 GTTTTAAACAAAAAGGTTGGTGG + Intergenic
940533120 2:154904949-154904971 GTGTAAACCACCAAGGCTTGGGG + Intergenic
943006560 2:182393237-182393259 GTGTAAGCCACCAAGGTTTGGGG + Intronic
943591037 2:189797041-189797063 TTGTAAATCTCTAAGGTTGGTGG + Intronic
945277806 2:208005919-208005941 GAGTAAAACAACAAGGTGGGTGG - Intronic
946528995 2:220551074-220551096 GATTAAAACATGAATGTTGGGGG + Intergenic
946658144 2:221970941-221970963 GAGAAAAACAGGGAGGTTGGGGG - Intergenic
947642434 2:231714532-231714554 GTGTGAAACACAAAGGTCGGGGG - Intergenic
948009119 2:234636657-234636679 GTGTAAGCCACCAAGGCTGGGGG - Intergenic
1172385586 20:34531934-34531956 GTGTAAAAAGAGAAGGTTAGGGG + Intronic
1172772902 20:37392035-37392057 GTGTACAACAAGGAGGTGGGTGG + Intronic
1177171513 21:17660971-17660993 GTGTAAAATAAGAAGTGTGGGGG + Intergenic
954931285 3:54284646-54284668 GTGTAAAAAATGAATTTTGGTGG + Intronic
956604651 3:71061811-71061833 TTGGCAAAAACGAAGGTTGGAGG - Intronic
957813157 3:85254748-85254770 GAGGAACACAAGAAGGTTGGGGG + Intronic
959063895 3:101638531-101638553 GTAAAAATCAGGAAGGTTGGTGG + Intergenic
959089212 3:101884591-101884613 CTGTAAAACACTAAACTTGGTGG + Intergenic
961971779 3:130976022-130976044 GTGTAAGACTCGGGGGTTGGTGG + Intronic
966298078 3:178446926-178446948 TTGTAAAACCCAAAGGTTGGAGG - Intronic
966601991 3:181785047-181785069 GTGGAAAAGAAGAAAGTTGGAGG - Intergenic
967586094 3:191216145-191216167 GTGTAAACCACCAAGGCTTGGGG + Intronic
970663592 4:18312445-18312467 GTGGAAACCACCAAGGTTTGGGG + Intergenic
976216722 4:82721983-82722005 GTGTGCAACAGGAAGGGTGGAGG - Intronic
978709675 4:111764342-111764364 GTGTAAAACAGGAATACTGGTGG + Intergenic
979966878 4:127086589-127086611 GTGTAAGACACCAAGGATTGGGG - Intergenic
984300887 4:177916424-177916446 GTGCAGAACATGCAGGTTGGTGG + Intronic
984444406 4:179817003-179817025 TTTTAAAAGAAGAAGGTTGGAGG + Intergenic
989791020 5:45402003-45402025 ATCTAAAACACGAAGTTTGATGG + Intronic
990967894 5:61469700-61469722 GTCTAAAAAAAAAAGGTTGGGGG - Intronic
991939665 5:71838538-71838560 GAGTAAAACAGGAGGGGTGGAGG - Intergenic
992477826 5:77121068-77121090 TTGTAAGACACTAAGTTTGGAGG - Intergenic
994606265 5:101971089-101971111 TTGTAAGACAAGAAGGCTGGAGG - Intergenic
995698443 5:114905804-114905826 GTGTAAGCCACGAAGGCTTGGGG + Intergenic
1001433720 5:171683270-171683292 CTGCAAAACAGGAAGGATGGAGG + Intergenic
1002076833 5:176713290-176713312 GTGTAAAAAACGTAGCCTGGGGG + Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1010819417 6:80395928-80395950 GTGTAAACCACCAAGGCTTGAGG - Intergenic
1012281037 6:97328597-97328619 GTGGAAGCCACGAAGGTTTGGGG - Intergenic
1012738930 6:102989240-102989262 CTGTAAAACTCGAAGGTCCGTGG - Intergenic
1012864700 6:104604462-104604484 CTGAAAAACACCAAGTTTGGGGG + Intergenic
1014247482 6:119083070-119083092 GTGTAAGCCACCAAGGTTTGGGG + Intronic
1019799292 7:3076416-3076438 GTTTAAGCCACGAAGTTTGGGGG + Intergenic
1026206055 7:68258470-68258492 GTGTAAGAAATGAAGGTTGAAGG + Intergenic
1032492515 7:132334116-132334138 GTGTAAAACACGGAAGCTGTAGG + Intronic
1037206002 8:16320808-16320830 GTGTAAGCCACGAAGGCTTGGGG - Intronic
1037686038 8:21140371-21140393 GTGAAAAACAGAAAGGTTGTGGG + Intergenic
1039422082 8:37451702-37451724 GCGTAAAAGTGGAAGGTTGGAGG - Intergenic
1040579060 8:48680938-48680960 CTGTAAAACATGTAGGTAGGAGG - Intergenic
1042266018 8:66910040-66910062 GTGTAAGCCACCAAGGTTTGGGG - Intronic
1042967464 8:74370295-74370317 ATGAAAAACACAAAGGTTGGAGG + Intronic
1044143385 8:88682944-88682966 GTATACAACAGGAAGGTTGGAGG + Intergenic
1046494667 8:114997849-114997871 GGGTAAATCAAGAAAGTTGGAGG + Intergenic
1047360595 8:124165287-124165309 GAGTAAAACAGGAAGGCTGAAGG + Intergenic
1047723281 8:127662188-127662210 TTGTAAACCACTAAGGTTTGGGG + Intergenic
1050539103 9:6654859-6654881 ATGTAAGACAAGAAGGCTGGAGG - Intergenic
1051357985 9:16257248-16257270 GGGTAAAACACGAAGGTGCGTGG - Intronic
1051797281 9:20886772-20886794 GCTTAAAACACAAAGGCTGGGGG + Intronic
1055430753 9:76241095-76241117 GTGTAAAACACAGAAGTTTGTGG + Intronic
1060080785 9:120642516-120642538 GTGTAAAACATCAAGAATGGAGG + Intronic
1186029253 X:5348921-5348943 TTGAAAAACATGAGGGTTGGGGG - Intergenic
1187598393 X:20800137-20800159 GTGTAAGCCACCAAGGTTTGGGG - Intergenic
1189022751 X:37358648-37358670 TTGTAGAACACCAAAGTTGGTGG - Intronic
1194120438 X:89956578-89956600 CTATAAAACATGAAGGTTGAGGG - Intergenic
1194409845 X:93544013-93544035 GTGGAAACCACCAAGGTTTGTGG + Intergenic
1195423133 X:104697835-104697857 GTTTAAAACACTAATTTTGGGGG - Intronic
1196273693 X:113741451-113741473 GTGTAAAACAGATATGTTGGAGG - Intergenic
1196376449 X:115038397-115038419 GTAAAAAACAGGAAGGTGGGTGG + Intergenic
1200473302 Y:3614101-3614123 CTATAAAACATGAAGGTTGAGGG - Intergenic
1201698550 Y:16854353-16854375 CTGTCAAACAGGAAGGATGGAGG - Intergenic