ID: 1083228955

View in Genome Browser
Species Human (GRCh38)
Location 11:61303012-61303034
Sequence CTCCCCACCACTCCCAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 1, 2: 2, 3: 58, 4: 443}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083228945_1083228955 18 Left 1083228945 11:61302971-61302993 CCCAATGCTTGCATCCACCAGAG 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1083228955 11:61303012-61303034 CTCCCCACCACTCCCAGAGCTGG 0: 1
1: 1
2: 2
3: 58
4: 443
1083228944_1083228955 30 Left 1083228944 11:61302959-61302981 CCTGACACAGAACCCAATGCTTG 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1083228955 11:61303012-61303034 CTCCCCACCACTCCCAGAGCTGG 0: 1
1: 1
2: 2
3: 58
4: 443
1083228948_1083228955 4 Left 1083228948 11:61302985-61303007 CCACCAGAGACCAAGGAACTCCC 0: 1
1: 0
2: 0
3: 24
4: 153
Right 1083228955 11:61303012-61303034 CTCCCCACCACTCCCAGAGCTGG 0: 1
1: 1
2: 2
3: 58
4: 443
1083228949_1083228955 1 Left 1083228949 11:61302988-61303010 CCAGAGACCAAGGAACTCCCAGC 0: 1
1: 0
2: 2
3: 24
4: 207
Right 1083228955 11:61303012-61303034 CTCCCCACCACTCCCAGAGCTGG 0: 1
1: 1
2: 2
3: 58
4: 443
1083228950_1083228955 -6 Left 1083228950 11:61302995-61303017 CCAAGGAACTCCCAGCCCTCCCC 0: 1
1: 1
2: 6
3: 57
4: 559
Right 1083228955 11:61303012-61303034 CTCCCCACCACTCCCAGAGCTGG 0: 1
1: 1
2: 2
3: 58
4: 443
1083228946_1083228955 17 Left 1083228946 11:61302972-61302994 CCAATGCTTGCATCCACCAGAGA 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1083228955 11:61303012-61303034 CTCCCCACCACTCCCAGAGCTGG 0: 1
1: 1
2: 2
3: 58
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083228955 Original CRISPR CTCCCCACCACTCCCAGAGC TGG Intronic
900899428 1:5506817-5506839 ATCGCCCCCACACCCAGAGCGGG + Intergenic
900962563 1:5934604-5934626 CTCCCCACTGCTCCCAGTCCCGG + Intronic
901227195 1:7620651-7620673 CCGCCCAGCACTCACAGAGCAGG + Intronic
901416736 1:9121725-9121747 CTTCCCACTGCCCCCAGAGCAGG + Intronic
901701374 1:11046444-11046466 TTCCCCACCTTTCCCAGGGCAGG - Intronic
901870778 1:12138165-12138187 CTCCCCACCAGTCTCTGAACTGG - Intronic
902380733 1:16051087-16051109 CCCCCCACCACCACCAGAGCTGG - Intronic
902406081 1:16184402-16184424 CTGCCCAGGAGTCCCAGAGCTGG - Intergenic
902409563 1:16205173-16205195 CTCCCCACGGCTCCCCCAGCTGG - Exonic
902777347 1:18683136-18683158 CTCCCCTGCACCCCCAGAGTAGG + Intronic
903184259 1:21620405-21620427 CTCCCCACCTCTCCCGGAAGGGG + Intronic
903995933 1:27305618-27305640 GTCCCCTCCACTCCCAGGGTGGG + Intronic
904036837 1:27563626-27563648 CACCCCAGCACTGCCAGAGCCGG + Intronic
905944974 1:41894067-41894089 CTCGCCACCACACCAAGTGCAGG + Intronic
907286818 1:53385808-53385830 CTCCAGATCTCTCCCAGAGCTGG + Intergenic
907887449 1:58606625-58606647 CTCCCTACCACTATCATAGCTGG - Intergenic
908111753 1:60904852-60904874 CTCACCCCCACCCACAGAGCAGG + Intronic
910896480 1:92075332-92075354 GTCTCCTCCAGTCCCAGAGCAGG + Exonic
912429274 1:109620592-109620614 CTTCCCCCTCCTCCCAGAGCTGG + Intronic
912682401 1:111737911-111737933 CTGCCCCCTACCCCCAGAGCTGG + Intronic
914450177 1:147784621-147784643 CTTCCCACCACAGGCAGAGCTGG - Intergenic
914747299 1:150509856-150509878 CTCGCCCCCACTCCCAGCCCTGG + Exonic
914946580 1:152072337-152072359 TTCCACACCACTCCCAGGCCTGG + Intergenic
915151656 1:153837408-153837430 CTCCCCACCCCTACCTTAGCTGG - Intronic
915304327 1:154969159-154969181 TTCCCCACAACTCCCAAGGCTGG + Intronic
915832223 1:159141759-159141781 CCCCCCACCGCTCAGAGAGCAGG - Intronic
916502717 1:165400556-165400578 CTCCCACCAACTCCCAGAACCGG + Intergenic
916824351 1:168429916-168429938 CTCCCCACCACAGCCAGCTCTGG + Intergenic
918082962 1:181221614-181221636 CTCCCCTACCCTCCCAGAGCAGG + Intergenic
920227193 1:204447346-204447368 CCCACCTCCACTCCCAAAGCAGG + Intronic
920248858 1:204608800-204608822 CTCCCCACCTCACCCATAGGTGG - Intergenic
920334163 1:205233126-205233148 CTCCCCACCTCTCTCACAGTGGG + Intronic
920357594 1:205386172-205386194 CTCCCCACCCCACCCTGCGCTGG - Intronic
920607705 1:207405995-207406017 CTTCCCACCACCCCCTGAGGGGG + Intergenic
920784266 1:209025843-209025865 CACCCCAACACCCCCAGAGCTGG + Intergenic
920850502 1:209625108-209625130 TTCCCCACCACTCACACACCTGG + Intronic
921732563 1:218594302-218594324 CTCCATACCACCCCCAGAGAAGG - Intergenic
922335668 1:224616635-224616657 CTCCTCCCAAATCCCAGAGCCGG - Exonic
922465950 1:225845720-225845742 GCCCCCACCCCTCCCAGCGCAGG + Exonic
922765198 1:228152813-228152835 TGCCTCACCACTCCCAGACCTGG + Intronic
923052515 1:230398731-230398753 CACCCCACAGCTCCCAGAACTGG + Intronic
923063308 1:230496684-230496706 CTCTCCAACACTCCCAAGGCAGG + Intergenic
923650908 1:235872669-235872691 CTGCCCACCTCTCAAAGAGCTGG - Intronic
1062824112 10:556194-556216 CCACCCACCCCTCCCACAGCCGG + Intronic
1062824127 10:556232-556254 CCACCCACCCCTCCCACAGCCGG + Intronic
1062824171 10:556343-556365 CCACCCACCCCTCCCACAGCCGG + Intronic
1063194389 10:3727661-3727683 CTCCCCACCGCCCCCAGCTCCGG - Intergenic
1063596421 10:7439947-7439969 CTCCCCAGCACTCACACTGCTGG - Intergenic
1066025533 10:31355551-31355573 CTCCCCCACCATCCCAGAGCAGG - Intronic
1066190074 10:33048076-33048098 CTCCCCACCACTCAGAAAACTGG - Intergenic
1067208872 10:44242190-44242212 CTCCCCACCTGTACCAGGGCAGG - Intergenic
1069593535 10:69656273-69656295 CTGGCAACCACTCCCGGAGCAGG - Intergenic
1069830704 10:71280696-71280718 CTCCCCACATCTCCCAGAACTGG + Intronic
1070814344 10:79313444-79313466 TTCCCCACCAGTCCCCAAGCAGG - Exonic
1071071221 10:81696844-81696866 CTCCCCACCACCCCCAGGCAAGG + Intergenic
1071458833 10:85872485-85872507 CTCCCCACTACACCCCAAGCAGG + Intronic
1071695391 10:87863943-87863965 CTCCCCCCCGCTCCAGGAGCGGG - Exonic
1072804287 10:98414937-98414959 CTCCCCACCAAGCTCTGAGCAGG + Intronic
1073191117 10:101651199-101651221 CTTCCCACCGCTCACAGAGCTGG - Intronic
1073447382 10:103589729-103589751 CTCCTCTCCACTCCCAGCCCCGG - Intronic
1073693223 10:105834859-105834881 CACCCCACAACTCCCACAGATGG - Intergenic
1075887455 10:125913706-125913728 CTTGCCCCCAGTCCCAGAGCTGG - Intronic
1075964346 10:126598187-126598209 CTGCCCACCAGTGGCAGAGCTGG + Intronic
1076404712 10:130203969-130203991 CTCCCCAGCACTGTCAGGGCTGG - Intergenic
1076693291 10:132234638-132234660 CATCCCACCACTCCCCAAGCAGG - Intronic
1076724765 10:132408144-132408166 GGCACCCCCACTCCCAGAGCAGG - Intronic
1076769562 10:132655665-132655687 CCCCCCACCCCTCCCACTGCAGG - Intronic
1077108908 11:853580-853602 CTCCCCACTCCACCCAAAGCTGG - Intronic
1077122746 11:917799-917821 CTCCCCACCCCTCCCCCAGCTGG + Intergenic
1077251054 11:1560900-1560922 CCTCCCACCTCTCCCAGAGGAGG + Intronic
1077309930 11:1883784-1883806 CTCCCCACCAGCTCCAGAACTGG + Intronic
1077325669 11:1962963-1962985 CTCCCACCCTCTCGCAGAGCTGG - Intronic
1078066379 11:8081641-8081663 CTCCCCACCTATCCCAGCACTGG + Intronic
1078099049 11:8318832-8318854 CTCCCTTCCACTCTCTGAGCAGG - Intergenic
1078742405 11:14079532-14079554 TTCCCCACCCCTCCCACAACAGG - Intronic
1079918367 11:26399543-26399565 CTCCCTGCCACTCCCAGATATGG - Intronic
1080201857 11:29680953-29680975 CTACCCACTATTCCCATAGCAGG + Intergenic
1081592911 11:44437412-44437434 CTCCTACCCACACCCAGAGCAGG - Intergenic
1081656026 11:44858214-44858236 CTGCCCCCCACTCCCACATCTGG + Intronic
1081705932 11:45181847-45181869 CTGCTCACCACTCCGAGACCAGG + Exonic
1082027557 11:47584040-47584062 CTGCTCACCACTCCCACATCAGG - Intronic
1082044118 11:47711150-47711172 CTCCCCACTACCCCAAGAGCAGG + Intronic
1082092534 11:48101590-48101612 CTCCACATCCCTCCCAGAGGAGG - Intronic
1082796027 11:57378371-57378393 CTCCCACCCACCCCAAGAGCTGG - Intronic
1083228955 11:61303012-61303034 CTCCCCACCACTCCCAGAGCTGG + Intronic
1083274315 11:61588122-61588144 GGCCCCAGCACTCCGAGAGCTGG + Intergenic
1083294361 11:61707203-61707225 CCTCCCACCACACCCTGAGCAGG + Intronic
1083388652 11:62332224-62332246 CTCCCCCCACCTCCCAGTGCTGG - Intergenic
1083478115 11:62926828-62926850 CCCCCCACCACCCCCCGAGGCGG + Intergenic
1084122585 11:67078058-67078080 GTCCCCGCCTCTCCCAGTGCCGG - Intergenic
1084463192 11:69307614-69307636 CCCCCCACAACCCCGAGAGCTGG - Intronic
1084889620 11:72230283-72230305 CTGCCCACCCCTCCCAGGTCTGG - Intronic
1085311445 11:75519316-75519338 CTCCCCTCCCCACCCAGCGCCGG + Intronic
1085415228 11:76315273-76315295 CTCCCCACACCTCCCTGGGCAGG + Intergenic
1087212029 11:95454320-95454342 CTCCCCTCCTTTGCCAGAGCCGG - Intergenic
1087395332 11:97589550-97589572 CTCCCTACTACTACCACAGCTGG + Intergenic
1088570428 11:111218661-111218683 CTCCTCACAGCTGCCAGAGCTGG + Intergenic
1088686141 11:112285986-112286008 ATCCCCAGGTCTCCCAGAGCTGG + Intergenic
1089128515 11:116193913-116193935 CTCCCCATCAAACCCAGACCAGG - Intergenic
1089504880 11:118956434-118956456 CTTCCCACCCCTGCCAGAGATGG - Intronic
1089515270 11:119028089-119028111 CTCCACACCCAACCCAGAGCAGG - Intronic
1089760261 11:120717799-120717821 CTGCCCACAAAGCCCAGAGCTGG - Intronic
1089847163 11:121467315-121467337 CTCCTCACCAATCCCAAGGCAGG - Intronic
1089848854 11:121479983-121480005 GTCCCCAGGACTCCCAGAGAGGG + Intronic
1090248208 11:125232417-125232439 CTCACCACCACCCTCAGAGGAGG + Intronic
1090778337 11:129984543-129984565 ATCCCCACCACTCCCTGAGACGG + Intronic
1202808649 11_KI270721v1_random:18142-18164 CTCCCACCCTCTCGCAGAGCTGG - Intergenic
1091847148 12:3666072-3666094 CTCCTCCCCACCACCAGAGCAGG - Intronic
1091983268 12:4884000-4884022 CTCCCTCCCACTCCCATGGCTGG + Intergenic
1093393284 12:18649918-18649940 CTCTCCACCACCTCCAGTGCTGG + Intergenic
1094818611 12:34208599-34208621 CTCCCAACCGCTCCAGGAGCCGG - Intergenic
1096460192 12:51818151-51818173 CCCCCCAGCATTACCAGAGCTGG + Intergenic
1096475731 12:51907666-51907688 CGCCCCGCCACCCGCAGAGCGGG + Exonic
1096648346 12:53050023-53050045 CTTCCCTCCACTTCCAGGGCCGG + Intronic
1097439800 12:59595967-59595989 CCCCCCACCACCCCCCGGGCCGG + Intergenic
1098533430 12:71568036-71568058 CTGCCTACCACACCCAGAACAGG + Intronic
1098949435 12:76624266-76624288 GTTCCCACCATTCCCAGAACTGG - Intergenic
1099190216 12:79554283-79554305 CTGCCCGCCGCTCCCAGTGCGGG + Intergenic
1100019316 12:90050297-90050319 CTCCCCACCACCCCCAGGAATGG - Intergenic
1101157054 12:101937777-101937799 TTCACCACCCCTCCCAGAGCTGG + Intronic
1102680846 12:114689354-114689376 CTCCCCATCTTTTCCAGAGCAGG + Intergenic
1103128847 12:118449023-118449045 CTCCCCACCACCCCCACAACAGG + Intergenic
1103775462 12:123364142-123364164 TTCCCCACCGCCCCAAGAGCGGG + Intronic
1103775480 12:123364223-123364245 CTCCCTCCCTCGCCCAGAGCCGG + Intronic
1103963917 12:124626195-124626217 GTCCCCACCCATCCCAGAGGAGG - Intergenic
1104596038 12:130120488-130120510 CTCCCCAGCACTTCCAGACCTGG + Intergenic
1104771148 12:131365609-131365631 CTCTCCCCCACTCCCCGATCAGG + Intergenic
1105071132 12:133235297-133235319 AACCCCGCCCCTCCCAGAGCCGG - Exonic
1105707542 13:22977441-22977463 CGCCCTGCCTCTCCCAGAGCCGG + Intergenic
1106913533 13:34487974-34487996 CTCCCAACCTCCCCCAGAGATGG - Intergenic
1107966313 13:45601467-45601489 CTCCTCACCTCTCCCAGGGGAGG - Intronic
1108699954 13:52935209-52935231 CTCACCTCCACTCCCAGTGCTGG + Intergenic
1113093545 13:106639276-106639298 CTCCCCACCATTTCCAAAGATGG - Intergenic
1113990647 14:16024856-16024878 CTCCCAACCGCTCCAGGAGCTGG - Intergenic
1113991388 14:16030315-16030337 CTCCCAACCGCTCCAGGAGCCGG - Intergenic
1114557171 14:23568666-23568688 CCCACCACAACTCCCAGAGTTGG + Exonic
1114665367 14:24374377-24374399 CTCGCCTCCTCTCACAGAGCAGG - Exonic
1115616101 14:35096219-35096241 CACCCCACCACCCCCAGTACTGG - Intronic
1115913325 14:38281089-38281111 CTACCCAACACTTGCAGAGCAGG - Intergenic
1116977086 14:51128680-51128702 TTCCTCACCAATGCCAGAGCAGG - Intergenic
1117601879 14:57384645-57384667 CTCCCCACCTCTCGCAAAACTGG - Intergenic
1118835596 14:69475704-69475726 CTCCCCAGCGCACCCAGAGATGG + Intergenic
1119729184 14:76940281-76940303 CTCCCCATCTCCCCCAGGGCCGG + Intergenic
1119775264 14:77244256-77244278 CTCCCACTCACTCCCAGGGCTGG - Intronic
1121329433 14:93040695-93040717 CTGCCCAGCACTCCCTGAGCAGG + Intronic
1121638117 14:95467421-95467443 CTCCCCACCACCCCCTGTCCCGG + Intronic
1121711643 14:96043076-96043098 CTGCCCACCACTTCAAGAGCTGG + Intronic
1122275391 14:100588169-100588191 CTCCTCTCTCCTCCCAGAGCGGG + Intergenic
1122660967 14:103294383-103294405 CTCCCCACGCCTCGCAAAGCTGG + Intergenic
1122870336 14:104635432-104635454 CACCCCAACCCTCCCAGGGCGGG - Intergenic
1122971486 14:105154051-105154073 TTCCCGGCCAGTCCCAGAGCGGG - Intronic
1202870678 14_GL000225v1_random:160378-160400 CTTGCCCCCAGTCCCAGAGCTGG + Intergenic
1123467940 15:20530003-20530025 CTACCCACAGCTCTCAGAGCTGG - Intergenic
1123650173 15:22471039-22471061 CTACCCACAGCTCTCAGAGCTGG + Intergenic
1123728254 15:23125212-23125234 CTACCCACAGCTCTCAGAGCTGG - Intergenic
1123740579 15:23279881-23279903 CTACCCACAGCTCTCAGAGCTGG + Intergenic
1123746419 15:23322677-23322699 CTACCCACAGCTCTCAGAGCTGG - Intergenic
1124278686 15:28345994-28346016 CTACCCACAGCTCTCAGAGCTGG - Intergenic
1124304014 15:28565614-28565636 CTACCCACAGCTCTCAGAGCTGG + Intergenic
1124354521 15:28984887-28984909 CTCCCCCCAACCCCCAGAGATGG - Intronic
1124532895 15:30522089-30522111 CTACCCACAGCTCTCAGAGCTGG + Intergenic
1124765761 15:32485555-32485577 CTACCCACAGCTCTCAGAGCTGG - Intergenic
1127054153 15:55114532-55114554 CTACCCACCACCCCCACAGCAGG + Intergenic
1128075122 15:64821077-64821099 GCCCCCACCAGTCCAAGAGCTGG - Exonic
1128342314 15:66831061-66831083 CTCCCCATCCCTCCCCGACCTGG + Intergenic
1128733125 15:70034262-70034284 CTCTGCACCATTCCCAGAGCAGG - Intergenic
1129200199 15:73994107-73994129 CTTCCCATCACTCACAGAACTGG + Intronic
1129266356 15:74395592-74395614 CTCCCCATCAGCGCCAGAGCAGG + Intergenic
1129317341 15:74753056-74753078 CTCCCCTCCCCTCCCAGTGTAGG + Intronic
1129859694 15:78851063-78851085 CTGCCCACCCCTTCCAGAGCTGG + Intronic
1130974456 15:88762573-88762595 CTCCCCACCGCACCCAGAATGGG + Intergenic
1131511375 15:93051212-93051234 CACCCCTCCACACCCAGAGGAGG - Intronic
1131670933 15:94618911-94618933 CTCTCCTTCACCCCCAGAGCAGG - Intergenic
1131693963 15:94855985-94856007 CTCCTCAACCCTCCCACAGCCGG + Intergenic
1131817088 15:96233342-96233364 CTCACCACCACACCCAATGCTGG + Intergenic
1132688765 16:1173025-1173047 CTCCACGCCACACCCAGGGCAGG - Intronic
1132995651 16:2821119-2821141 CTTGCCACCACTCCCAGCCCAGG + Intronic
1133000878 16:2850838-2850860 CACCCCAGCACTCCCTGGGCTGG + Intergenic
1133632156 16:7631420-7631442 CTCACCCCAATTCCCAGAGCAGG + Intronic
1134756844 16:16674635-16674657 CACCTCCCCACTCCCAAAGCTGG - Intergenic
1134989224 16:18684528-18684550 CACCTCCCCACTCCCAAAGCTGG + Intergenic
1136445542 16:30315480-30315502 TTCCCCACCCCTCCCCGAGATGG - Intergenic
1136610337 16:31362081-31362103 CTCCCCACAGCCCCCAGAACGGG - Exonic
1138081440 16:54094714-54094736 CTCCCTCCCAGCCCCAGAGCTGG + Intronic
1138345865 16:56319793-56319815 CTCCCCACCCCTCTCAATGCTGG + Intronic
1139481268 16:67232006-67232028 CTCCCCCCAACACCCATAGCTGG + Intronic
1140473469 16:75227289-75227311 CTCACCTCCTCTCCCAGAGGTGG - Intergenic
1141277792 16:82603935-82603957 ATCCCCACAGCTGCCAGAGCTGG + Intergenic
1141518394 16:84561602-84561624 CTCCCCAGCACTCCCTCAGCAGG - Intergenic
1141580675 16:84996430-84996452 CTCCTCGCCCCTCCCACAGCAGG - Intronic
1141900331 16:86986865-86986887 CTCCCCTCCCCTCCCTGATCTGG - Intergenic
1142684218 17:1568269-1568291 CTCCCCAGGACACCCAGAGATGG - Intergenic
1142885380 17:2909355-2909377 CGCCCCACCCCTCCCAGGGCTGG - Intronic
1143347439 17:6260351-6260373 CTCTCCAACCCTCCAAGAGCTGG + Intergenic
1143750274 17:9022242-9022264 CTCGCCACCCCGCCGAGAGCTGG + Intronic
1143775418 17:9195794-9195816 CCCCCCTCCAGCCCCAGAGCAGG + Intronic
1144705778 17:17366992-17367014 CTCCCCCGCACTCCCAGAGCAGG - Intergenic
1144849165 17:18235453-18235475 CTGCCACCCCCTCCCAGAGCTGG + Exonic
1145064395 17:19752330-19752352 CTCCCCACCCTTCCCAGCCCTGG - Intergenic
1145792543 17:27636971-27636993 GTCCCCACCACTCCCCCACCTGG + Intronic
1145807420 17:27744837-27744859 GTCCCCACCACTCCCCCACCTGG + Intergenic
1146437308 17:32862086-32862108 CTCCCCACCTCTCCCCCAACAGG + Intronic
1147234301 17:39045855-39045877 CTCCCCACCACGCCTAGATGTGG - Intergenic
1147311140 17:39596810-39596832 CCCCCCACCACCCCCGCAGCTGG + Intergenic
1147602613 17:41755513-41755535 CTGCCCACCACCCCCAGAAGGGG + Exonic
1148049134 17:44760590-44760612 CACCCCAGCGCTCCAAGAGCTGG + Intronic
1148050182 17:44766242-44766264 CTCCCCACCACTTCCAGACACGG - Intronic
1148572125 17:48678551-48678573 GCCCCCAGCACTCCCGGAGCTGG + Intergenic
1148913701 17:50957031-50957053 CCACCACCCACTCCCAGAGCAGG - Intergenic
1149017450 17:51924770-51924792 CTCCTCACCCCTTCCAGACCTGG + Intronic
1149492945 17:57098300-57098322 CTCCCCACCAACCCTAGGGCAGG + Intronic
1149543448 17:57485833-57485855 CTCCCCTCCACGGCCAGAGCAGG - Intronic
1149574731 17:57703451-57703473 CCCTCCACCACTGCCAGAGTGGG + Intergenic
1150613707 17:66753176-66753198 CTCCCCACCAGTCCCCAGGCTGG + Intronic
1151679343 17:75615387-75615409 CCCTCCTCCAGTCCCAGAGCTGG - Intergenic
1152110188 17:78353472-78353494 TTCCCCCCCTCCCCCAGAGCAGG + Intergenic
1152166366 17:78710208-78710230 CTCCAAACCCCTCCCAGAGATGG - Intronic
1152592205 17:81219142-81219164 CTCCTCCCTACTCCCAGAGGTGG + Intronic
1152703222 17:81829779-81829801 CACCCCACCCCACCCAGTGCTGG + Intronic
1153056361 18:950024-950046 CCCTCCACCACTCCCCCAGCAGG - Intergenic
1153787563 18:8548315-8548337 CTCCCCACCACTCCTAACTCTGG - Intergenic
1154010703 18:10571774-10571796 CTTGCCTCCACTCCCAGAGGGGG - Intergenic
1155092540 18:22525731-22525753 CTCTCCACAACTCTAAGAGCTGG + Intergenic
1155440865 18:25861267-25861289 CTCCCCACCTCTCTCACTGCTGG - Intergenic
1157201591 18:45664302-45664324 CTCCCCACCATTGCCATAGATGG - Intronic
1157600783 18:48891992-48892014 CTCCCCAGGTCTCACAGAGCCGG - Intergenic
1160440216 18:78883937-78883959 CTCCCCACCAACCCCACTGCAGG + Intergenic
1160662143 19:306185-306207 CTGCCCACGACCCCCAGGGCTGG + Exonic
1160699283 19:498275-498297 CACCCCAACTCTCCCAGGGCCGG + Intronic
1160796754 19:949228-949250 CTGCCCACCCCTCCCAGCGGCGG + Intronic
1161938330 19:7386047-7386069 CTCCCCGCCACCCCCGGGGCTGG + Intronic
1163268200 19:16233996-16234018 CTGCTCACCACTTCCAGAGGCGG + Intronic
1163592997 19:18204747-18204769 CTCCCCACCATTCCCAGAAAAGG + Intergenic
1164308856 19:24029327-24029349 TCCCCAACCACCCCCAGAGCCGG + Intergenic
1165005185 19:32799368-32799390 CTCCACACCCCTGCCAGAGCAGG + Intronic
1165132459 19:33641404-33641426 CGCCCCACCACCCCCTGGGCAGG + Intronic
1165318848 19:35074015-35074037 CTGCCCACCAACCCCAGACCTGG + Intergenic
1165757893 19:38304743-38304765 CTCCCCGCCAGCCCCAGTGCGGG - Intronic
1165846567 19:38821578-38821600 CGGCCCACCACTCCGAGTGCGGG - Intronic
1166079375 19:40434101-40434123 CTTCCCGCCACGCCCAGGGCGGG + Intergenic
1166204438 19:41259868-41259890 CTCCCCAGCAGCCCCAGGGCAGG + Exonic
1166399366 19:42466763-42466785 CTCCTCACCACACCCACAGTGGG - Intergenic
1166767534 19:45260871-45260893 CCCACCACCTCTTCCAGAGCAGG + Intronic
1166811136 19:45515284-45515306 CTCCCCACCCCACCCACACCAGG - Intronic
1166979296 19:46623424-46623446 CTCCCCACTCCTCCCAGCTCCGG + Intronic
1168638249 19:58012932-58012954 TTCCCCACCATTCCCAGATGGGG - Intergenic
1202647980 1_KI270706v1_random:158517-158539 CTTCCCATCAGTCCCTGAGCTGG + Intergenic
925008866 2:467389-467411 CTCCCCGCCCCGCCCGGAGCTGG + Intergenic
925129794 2:1486782-1486804 CTCCCCACTACGCCTGGAGCCGG - Intronic
925362185 2:3287072-3287094 CTCCCCACCACCCCCTCTGCCGG - Intronic
925457061 2:4024763-4024785 CTCCCAGCCACTGCCTGAGCTGG + Intergenic
925590852 2:5507827-5507849 CTCCCCCCCACCCCCAGCCCCGG - Intergenic
926037218 2:9645321-9645343 CCACCCACCACCCCCAGGGCTGG - Intergenic
926170477 2:10550023-10550045 CTCCCCACCTGGCACAGAGCAGG - Intergenic
927258581 2:21062744-21062766 CTTCCCACCTCTCCCTGGGCTGG + Intergenic
928593534 2:32840085-32840107 CTCCCGACCACCCCCAGCACTGG + Intergenic
929165289 2:38875679-38875701 ATCCCGACCACTCCTGGAGCAGG + Intronic
929419061 2:41772424-41772446 CTCTCCACCAGTCTGAGAGCAGG + Intergenic
930155867 2:48107094-48107116 CTCCTGAGCACTCCCAGGGCGGG + Intergenic
932366306 2:71155605-71155627 CTACCCACAACTCTCGGAGCTGG + Intergenic
932925536 2:75969313-75969335 CTCGCCACTTCTACCAGAGCAGG + Intergenic
933052004 2:77612009-77612031 CTCACCACAGTTCCCAGAGCTGG - Intergenic
933551335 2:83780971-83780993 CCCACCACCAATCCCATAGCAGG + Intergenic
934529867 2:95078300-95078322 CTCCCCTCAACTCTCTGAGCTGG + Intergenic
934764698 2:96874192-96874214 CTCCCAGCCAGTCCCAGAGAGGG + Intergenic
935062874 2:99623488-99623510 CTCCCCACCTCTGCCAGCCCAGG + Intronic
935469703 2:103443583-103443605 CTCCCCAGCACCCCCTAAGCAGG + Intergenic
935626307 2:105174958-105174980 CTCCCCAACACTCCCCCACCAGG + Intergenic
936042688 2:109161775-109161797 CTCACCACCACCCCCAGGGAGGG + Intronic
936501765 2:113072378-113072400 CTCCACCCCACTCTCAGGGCTGG + Exonic
936786376 2:116098478-116098500 GTCCCCACACTTCCCAGAGCTGG - Intergenic
937071236 2:119065324-119065346 CTCCCCACTACTTCCAGCCCTGG + Intergenic
937354203 2:121187859-121187881 CTCCGCCCCACACCCAGGGCTGG + Intergenic
937392149 2:121498320-121498342 CACCCCACCACCCCCCCAGCTGG + Intronic
938989045 2:136609292-136609314 CACCCCAACTCACCCAGAGCGGG + Intergenic
939115474 2:138055798-138055820 CATCCCACCACTCCCATATCAGG + Intergenic
939559033 2:143712123-143712145 CTCCCTATCACTCCCTTAGCTGG - Intronic
940639496 2:156332275-156332297 CTCCCCACTAGTGCCAAAGCCGG + Intronic
941488277 2:166109855-166109877 CTCCCCACCACCCACATAGTAGG - Intronic
942577304 2:177377718-177377740 ATCCCCACCATTCCCAGATGGGG - Intronic
943966526 2:194341100-194341122 CTCCCCTCCACCCCTAGAACAGG + Intergenic
945472335 2:210241303-210241325 GTCCACCACACTCCCAGAGCTGG + Intergenic
945726721 2:213478755-213478777 CCTCCCACCACTCACAGAGTAGG - Intronic
946089518 2:217208211-217208233 TTCCCCTCCACTTCCAGAGCGGG - Intergenic
946154112 2:217796040-217796062 CTCCCCACCAGTCCAAGCACAGG + Intergenic
946279911 2:218659364-218659386 CTCACCTCCAGACCCAGAGCCGG + Exonic
946410124 2:219511587-219511609 CTCCCCGGCACTCCCAGTCCAGG + Intergenic
946562680 2:220929906-220929928 CTGCCCACCACTACAAGAGGAGG - Intergenic
946690326 2:222304449-222304471 CTCCTCACCACAACCAAAGCAGG + Exonic
947574536 2:231262157-231262179 CTTGCCACCACTCCCCAAGCTGG + Intronic
947994487 2:234515577-234515599 CTTCCCACCACTCCCCAAGCTGG + Intergenic
948208077 2:236173292-236173314 CTCCCCAACACTCCAAGGGCTGG - Intergenic
948229827 2:236341740-236341762 CTCCCCACCACACACAGCACAGG - Intronic
948407567 2:237733873-237733895 GCCCCCACCAAGCCCAGAGCCGG + Intronic
948969569 2:241414630-241414652 CACCTCACCACTCCCAGTGTGGG + Intronic
1168888429 20:1276378-1276400 TTCCCAACCACTCAGAGAGCAGG - Intronic
1169011615 20:2255976-2255998 CTCCCTGCCACACCCAGAGTTGG + Intergenic
1169301584 20:4446134-4446156 CTCACCACTGCTCCCAGAGAAGG - Intergenic
1169338991 20:4781685-4781707 CTCCCCACCACCCCCACCCCGGG - Exonic
1169839625 20:9920650-9920672 CACCACACCCCGCCCAGAGCTGG + Intergenic
1170073209 20:12391322-12391344 CTCCCCACCATGCCCACAGTGGG + Intergenic
1171077438 20:22142787-22142809 CTCACCATCACTCCCTGAGCAGG - Intergenic
1171154433 20:22859306-22859328 CTCCCCACCACTCCCTCCACAGG - Intergenic
1171813203 20:29762169-29762191 CTCCCAACCCCTCCAGGAGCCGG + Intergenic
1171824103 20:29878818-29878840 CTCCCAACCGCTCCAGGAGCCGG - Intergenic
1171905280 20:30894621-30894643 CTCCCAACCGCTCCAAGAGCTGG - Intergenic
1171906029 20:30900147-30900169 CTCCCAACCACTCCAGGAGCCGG - Intergenic
1172623613 20:36335116-36335138 CACCCCACCTCTTACAGAGCTGG + Intronic
1172884979 20:38224832-38224854 CTCCCCACAACCCCAAGAGGGGG - Intronic
1172995743 20:39069337-39069359 CCCCTCCCCACACCCAGAGCTGG + Intergenic
1173683136 20:44901298-44901320 CTTCCCAACAGTCCCAGAGTAGG - Intronic
1174484161 20:50851057-50851079 CCCCCCACCACTTGCAGGGCTGG - Intronic
1174914834 20:54643613-54643635 CTCCCCAGTACTCCCAGGCCTGG - Intronic
1175225617 20:57442255-57442277 CTCCCAGCCACTCCCAGTGCTGG + Intergenic
1175810338 20:61854264-61854286 CTGCCTTCCAGTCCCAGAGCTGG - Intronic
1175820845 20:61908023-61908045 CTTCCTACCAGACCCAGAGCTGG + Intronic
1175856874 20:62125720-62125742 CTTCCCACTGCTCCCAAAGCCGG - Intronic
1175863329 20:62161662-62161684 CACCCCACCCCTCACAGGGCTGG + Intronic
1175903675 20:62369757-62369779 CTCCCCTCCACTCCCAGACTGGG - Intergenic
1176109470 20:63404871-63404893 CTCCTCACCCCTCCCTGTGCTGG - Intergenic
1176198154 20:63847509-63847531 CTCCCCACAAGCCCCACAGCTGG - Intergenic
1176603866 21:8814212-8814234 CTTCCCATCAGTCCCTGAGCTGG - Intergenic
1177936519 21:27352893-27352915 CTCTCCACCAATGCCAGTGCAGG - Intergenic
1178430258 21:32512557-32512579 CTCCCCTCCTCTCCCAGTGGTGG - Intronic
1179886021 21:44314575-44314597 CCCCCCATCCCTCCCAGAGGCGG - Intronic
1180315880 22:11277209-11277231 CTCCCAACCGCTCCAGGAGCCGG + Intergenic
1180316623 22:11282670-11282692 CTCCCAACCGCTCCAGGAGCTGG + Intergenic
1180338710 22:11600825-11600847 CTCCCAACCGCTCCAGGAGCTGG - Intergenic
1180339452 22:11606267-11606289 CTCCCAACCACTCCAGGAGTCGG - Intergenic
1180346151 22:11705789-11705811 CTTCCCATCAGTCCCTGAGCTGG - Intergenic
1180645487 22:17335105-17335127 CCCCCCACCACTCCCTGACCTGG - Intergenic
1181531887 22:23521791-23521813 CCCCCCACCACCACCCGAGCAGG + Intergenic
1181989850 22:26829185-26829207 ATATCCACCACACCCAGAGCAGG + Intergenic
1183325080 22:37187096-37187118 CTGCCCCCCACCCCCAGAGCTGG + Intronic
1183376351 22:37467680-37467702 CTCCCCACCCCACCCAGGGAAGG - Intergenic
1183475741 22:38034854-38034876 CCTCCCACCACTCCCAGCCCTGG - Intronic
1183666084 22:39246646-39246668 CTCCAGACCACTCCAGGAGCAGG - Intergenic
1184310963 22:43642441-43642463 CTCCCCACCTCCCCCATACCAGG + Intronic
1184934824 22:47713728-47713750 TGCCCCACCACCCCCAGATCTGG - Intergenic
1185148853 22:49153076-49153098 CTCCCCACCACTCCCTGAGCGGG + Intergenic
1185403443 22:50630862-50630884 TTGACCACCACTCCCAGTGCCGG - Intergenic
949422250 3:3878431-3878453 CCCCCCACCACCTCCAGGGCTGG - Intronic
949534594 3:4986272-4986294 CTTCTCACAAGTCCCAGAGCAGG + Intergenic
949825026 3:8156264-8156286 CTCCCCACCCCCACCAGAGCCGG - Intergenic
950226387 3:11238138-11238160 CTCCCCACAACCCCCAGCCCTGG - Intronic
950554466 3:13686798-13686820 CTCCCCAGCTCGCCCAGAGAAGG + Intergenic
951040238 3:17981601-17981623 GTCTCCTGCACTCCCAGAGCTGG + Intronic
952299460 3:32091706-32091728 CTCCCCAACATTGCCAGATCTGG + Intergenic
952959615 3:38581110-38581132 CTCCCCGCCACCCCCAGAGACGG - Exonic
953406997 3:42664551-42664573 TTCCCCACCACTGCCAGCCCCGG + Exonic
953617903 3:44508408-44508430 CTCTTCACCACACCCAGAGGAGG + Intronic
953691856 3:45126389-45126411 ACCCCCACCCCTCCCACAGCAGG - Intronic
953820317 3:46202669-46202691 CTCCCCTTCACTCCCACCGCAGG - Exonic
954984412 3:54776837-54776859 CTTCCCACCACCCACACAGCAGG - Intronic
955920899 3:63954482-63954504 CTCACCAACACGTCCAGAGCAGG - Intronic
956659393 3:71583326-71583348 GCCCCCACCCATCCCAGAGCTGG + Intronic
957084970 3:75669978-75670000 CTCCCAACCGCTCCAGGAGCCGG + Intergenic
960982466 3:123243234-123243256 CTCCCCACCCCTCCCAGAATAGG - Intronic
960986123 3:123282208-123282230 CTCCCCAGCACCCCCAAGGCTGG + Intergenic
961272391 3:125699007-125699029 CTCCCCACCTCCCCCAGCCCCGG + Intergenic
961275254 3:125721244-125721266 CTCCCCACCTCCCCCAGCCCCGG + Intergenic
961913691 3:130347736-130347758 GTGCCCTCCACTCTCAGAGCTGG - Intronic
963168330 3:142226912-142226934 CTCCCCACTACTTGCAGATCAGG - Intergenic
963973687 3:151457509-151457531 CTCCTCACCACTCCCCCAGGTGG + Intronic
965099563 3:164278544-164278566 CTCCCCACAACCACCACAGCTGG - Intergenic
967922896 3:194625808-194625830 CTCCTTATCACTCCCAGAGCGGG - Intronic
968622844 4:1611440-1611462 CTCCTCACCAGTCCCAGGGCAGG + Intergenic
968634833 4:1672443-1672465 CTCCCCACCACCCCGTGAGGAGG - Intronic
969050325 4:4368519-4368541 CACCTCCCCACTCCCAGGGCTGG + Intronic
969316078 4:6381956-6381978 CTCTCCCCCACTCCCAGGGCTGG - Intronic
969431145 4:7155021-7155043 CACCCAGCCGCTCCCAGAGCAGG + Intergenic
969578103 4:8048148-8048170 ATCCCCACCCATCGCAGAGCTGG - Intronic
971167189 4:24196270-24196292 CCCCTTACCACTCCCAGAGAAGG + Intergenic
972730303 4:41788230-41788252 CTCTCCCCCACTCCCAGGGCTGG - Intergenic
973233253 4:47866724-47866746 GTTCCCACCATTCCCAGAACTGG + Intronic
973306729 4:48660388-48660410 GGACCCACCACTCCCAGAACTGG + Intronic
973374250 4:49276703-49276725 CTTCCCATCAGTCCCTGAGCTGG + Intergenic
973383162 4:49333536-49333558 CTTCCCATCAGTCCCTGAGCTGG - Intergenic
973386771 4:49518551-49518573 CTTCCCATCAGTCCCTGAGCTGG - Intergenic
974622977 4:64384960-64384982 CTGCCCACCACTGCCACTGCTGG - Intronic
975781927 4:77849045-77849067 CTCACCACCACGCCCACACCCGG + Intergenic
975923924 4:79426395-79426417 GTCACCACCACCCCCAGGGCTGG + Intergenic
978451660 4:108840547-108840569 CCTGCCACCACTCCTAGAGCTGG + Intronic
985434673 4:189917234-189917256 CTGCCCACCGCACCCTGAGCTGG + Intergenic
985445968 4:190021588-190021610 CTCCCAACCGCTCCAGGAGCCGG - Intergenic
985733632 5:1565162-1565184 CTCCTCACCCCTCCTGGAGCCGG + Intergenic
986532629 5:8755073-8755095 CTGCCCACCTCTGCTAGAGCAGG - Intergenic
990260791 5:54020357-54020379 ATCCCCACCTCTCCCAGAGTGGG + Intronic
991904547 5:71496584-71496606 CTCGCCACCACATCCAGAGACGG + Intronic
992014926 5:72565923-72565945 CTCGCCATCACCCCCACAGCTGG - Intergenic
992799733 5:80285011-80285033 CTCCCCACCCCACCCAGAGAGGG + Intergenic
994208191 5:97059578-97059600 CTCCCTACTACTACCACAGCTGG - Intergenic
996927066 5:128840260-128840282 TTCCACAGCATTCCCAGAGCTGG - Intronic
997341170 5:133145687-133145709 ATCCACAACACTCCCAGAGAGGG + Intergenic
997353554 5:133247981-133248003 CTCCCCACAAGTCTCAGAGTTGG + Intronic
998547134 5:143039043-143039065 CTCCCCACTGCTCCCAGAACGGG - Intronic
1000337101 5:160249930-160249952 GTCCCCACCCCTCCTAGAGAAGG + Intergenic
1002436965 5:179237595-179237617 CTCCCCCAGCCTCCCAGAGCTGG - Intronic
1002470976 5:179435984-179436006 CTCCCCACCCCTCCCAGGCATGG - Intergenic
1003154509 6:3579523-3579545 GTCCCCAGCACTCTCAGACCAGG + Intergenic
1003290980 6:4777220-4777242 CTCCCCGCCACCCCCCGACCAGG - Intronic
1005120138 6:22380288-22380310 ATCCCCGCCTCTCACAGAGCAGG - Intergenic
1006447721 6:34089183-34089205 CTCCCCACCACTCCCCTCTCTGG + Intronic
1006797474 6:36741050-36741072 TTCCCCACCTTTCCCACAGCAGG + Exonic
1006861637 6:37175205-37175227 CTCCCCATCACCCACAGAGCCGG - Exonic
1007121083 6:39382017-39382039 GTCCCCACCCCTCCCAGGGATGG - Intronic
1007248361 6:40478600-40478622 CAGCCCACCCCTCACAGAGCAGG + Intronic
1007627484 6:43254687-43254709 CTCCCCCCTACTCCCAGATCTGG + Intronic
1013318503 6:108963984-108964006 ATACCCACCACTCCCAGAGTTGG - Intronic
1014640177 6:123899729-123899751 ATCCCCACCTCTCCTAGACCAGG - Intronic
1015935795 6:138404763-138404785 CTCCCCGCTACCCCCAGTGCAGG + Intronic
1016370264 6:143366338-143366360 ATGACCACCACTCCCAGTGCAGG - Intergenic
1018478940 6:164170901-164170923 CTCCCCATCATTCCCAGGTCTGG + Intergenic
1019377306 7:699678-699700 CTCCCCACCCCTCCTGCAGCTGG - Intronic
1019736323 7:2651422-2651444 CTCCCCGCCCCTAGCAGAGCGGG - Intronic
1019739185 7:2664323-2664345 CTCACCACCCCTCTCAGGGCTGG - Exonic
1019746786 7:2705254-2705276 CTCCGCATCCCTCCCAGGGCAGG + Intronic
1020450431 7:8315360-8315382 CCTCCCACCACTACCAGAGCTGG - Intergenic
1022334696 7:29411505-29411527 CTGCCCACTAATCCCAGAGGTGG + Intronic
1022378862 7:29841230-29841252 CTCCCCAGGTCTTCCAGAGCCGG - Intronic
1023195585 7:37635465-37635487 CTCCCAGCCACTCCCAGTGGAGG - Intergenic
1023990176 7:45124091-45124113 CTCCCCACCACCCCCCTGGCCGG - Intergenic
1024273821 7:47661308-47661330 CTCCCCTCCACTCTCAGCGCAGG - Exonic
1025193393 7:56913424-56913446 CCCCCCACCCCCCCCATAGCTGG + Intergenic
1025678549 7:63663505-63663527 CCCCCCACCCCCCCCATAGCTGG - Intergenic
1026878802 7:73895078-73895100 CTCCCCACAACCCCCAGGGAGGG + Intergenic
1026899147 7:74027626-74027648 CTCCCCAACACCCCCAGGTCTGG - Intergenic
1026905400 7:74060213-74060235 CTCCCCAACGATCTCAGAGCTGG + Intronic
1027863665 7:83618087-83618109 CTTCTCACCACTCCCAATGCTGG - Intronic
1028105117 7:86867886-86867908 GTCCCCTCTGCTCCCAGAGCTGG - Intergenic
1028133920 7:87207248-87207270 CTCCCCAACACTCCCAGAGAGGG + Intronic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1029654849 7:101917527-101917549 CTCCCCAACACTGGCAGAGAAGG - Intronic
1029730035 7:102433235-102433257 CTCGCCTTGACTCCCAGAGCTGG + Intronic
1032061847 7:128731312-128731334 CTCCATGCCACTGCCAGAGCTGG + Exonic
1032094140 7:128929251-128929273 CTCACCCCCAATCCCAGTGCTGG + Intergenic
1032554378 7:132816583-132816605 CTCCCCCCAAATCCGAGAGCAGG + Intronic
1033649680 7:143331330-143331352 CTGCTCACCACACACAGAGCAGG - Intronic
1035074432 7:156168947-156168969 CCCCCAACCACCCCCACAGCTGG - Intergenic
1035280103 7:157773019-157773041 CTTCCCAGAACTCCCAGAACTGG + Intronic
1037616784 8:20526402-20526424 CTCCCCACCACCGCCATAGCTGG + Intergenic
1037917471 8:22781342-22781364 CTCCTCCCCACTCCCAGCCCCGG - Intronic
1040464257 8:47679499-47679521 CCCCCCACCCCTTCCAGTGCTGG + Intronic
1040984602 8:53280072-53280094 CAACCCTCCAGTCCCAGAGCTGG - Intergenic
1042012344 8:64261338-64261360 CTCCCTTGAACTCCCAGAGCAGG - Intergenic
1044418332 8:91961656-91961678 CTCCCCACCACACTCATAGGAGG - Intronic
1045952260 8:107865417-107865439 CCTCCCACCACCACCAGAGCAGG - Intergenic
1046625856 8:116576224-116576246 CTCCCCACTCCACCCTGAGCAGG - Intergenic
1047318155 8:123753568-123753590 GTCCCCACCACTCCCTGATCTGG + Intergenic
1047369859 8:124247319-124247341 CTCCCCACAACACCCAGGACAGG + Intergenic
1047588647 8:126302714-126302736 CTTCCCACCAACCCCAGAACAGG - Intergenic
1048030990 8:130631938-130631960 CATCTGACCACTCCCAGAGCTGG - Intergenic
1049234563 8:141506050-141506072 CTCACTCCCACTCCCAGAGTGGG - Intergenic
1049256016 8:141614356-141614378 CTCCCCTCCACCCCCAGCCCAGG + Intergenic
1049288835 8:141791035-141791057 CCCGCCACCACTCCCTGAGATGG - Intergenic
1049435597 8:142584778-142584800 CAGCCCACGGCTCCCAGAGCAGG + Intergenic
1049526652 8:143130198-143130220 CTTGCCACCTCTCCCAGACCTGG + Intergenic
1049653971 8:143789664-143789686 CTCCCCACCCCACCCCAAGCAGG - Intergenic
1050164045 9:2745943-2745965 TTCCCCATTAATCCCAGAGCTGG - Intronic
1051027540 9:12630969-12630991 CTTCCCCCCTCCCCCAGAGCAGG - Intergenic
1051659178 9:19409608-19409630 CTTCCCAGCACTCCGAGAGCAGG - Intronic
1054337267 9:63817927-63817949 CTCCCAACCGCTCCAGGAGCCGG - Intergenic
1056271836 9:84954745-84954767 GTCCCCACCAGCACCAGAGCTGG - Intronic
1056637145 9:88340626-88340648 CTCCCCACCACCCCCAAATGTGG + Intergenic
1056829713 9:89905950-89905972 CTCCCCACCTTCCCCAGAGTAGG - Intergenic
1056958037 9:91098336-91098358 CTCCCCAACTCTCCCACTGCGGG + Intergenic
1057905882 9:98983181-98983203 CTCCGCAACACTCACAGAGAAGG - Intronic
1058862064 9:109126278-109126300 ATCCCTCCCACTCCCATAGCTGG + Intergenic
1059425099 9:114216062-114216084 CTCGCCACCACATCCAAAGCAGG - Intronic
1060202310 9:121658470-121658492 CACCCCGCCACTCCTAGAGCGGG - Intronic
1060420848 9:123468576-123468598 CTCAGCATCCCTCCCAGAGCTGG + Intronic
1060544439 9:124452003-124452025 CTCCCACCCACCCCCAGAGTAGG + Intronic
1060813616 9:126623689-126623711 CTCCCCACCCCTCCCAGGCTGGG - Intronic
1060936322 9:127518187-127518209 CTCCCAACCACCCCAAGACCTGG + Intronic
1061239051 9:129358665-129358687 CTGCCCACTTCTCCCAGTGCAGG + Intergenic
1061291867 9:129655001-129655023 CTTCCCACGACTCCCAGGGAAGG + Intergenic
1061312889 9:129775476-129775498 CTCTCACCCACTCCAAGAGCTGG + Intergenic
1061541281 9:131278877-131278899 CTTCCAGCCAGTCCCAGAGCCGG + Intergenic
1061547821 9:131314983-131315005 CTCCCCACTACTCCACGAGCTGG - Intergenic
1061727966 9:132591423-132591445 CCCCCCACCAGAGCCAGAGCTGG - Intergenic
1062065144 9:134522639-134522661 GTACACAGCACTCCCAGAGCTGG + Intergenic
1062426491 9:136508523-136508545 CTCCCCACCACCCCCACACCAGG + Intronic
1203733779 Un_GL000216v2:116213-116235 CTTGCCCCCAGTCCCAGAGCTGG - Intergenic
1203364930 Un_KI270442v1:248622-248644 CTCCCAACCGCTCCAGGAGCTGG + Intergenic
1203551283 Un_KI270743v1:166372-166394 CTTCCCATCAGTCCCTGAGCTGG - Intergenic
1185509288 X:650738-650760 CTCCCCAGACCTCCCAAAGCTGG - Intronic
1186489595 X:9961126-9961148 CTCCCCACCAGCCCTAGAACTGG - Intergenic
1186516759 X:10172022-10172044 GTTCCCACCATTCCCAGAGCTGG - Intronic
1187414464 X:19081227-19081249 CTCACCCCCACACCCACAGCAGG + Intronic
1189117780 X:38360570-38360592 CTCCCCTCAACTCTCAAAGCTGG - Intronic
1190066508 X:47245149-47245171 CTCCCCACAACTCCTCTAGCTGG + Intronic
1190246331 X:48692995-48693017 CTCCCCACCCCACCCTGACCAGG + Intergenic
1190259332 X:48788054-48788076 CTGCCCACCCCTCCCATGGCAGG - Intronic
1191780809 X:64863204-64863226 CTCCCCACCTCCCCCACAGCAGG + Intergenic
1192065426 X:67879984-67880006 CTCCCCATAACTACCACAGCTGG - Intergenic
1192088155 X:68122088-68122110 CTCCCCACAGCTACCACAGCTGG - Intronic
1192340526 X:70259808-70259830 CTGCCCACCACTTCCCAAGCTGG - Intergenic
1192718599 X:73668993-73669015 CTCCCCACCTCTCCCTGGGATGG - Intronic
1193626505 X:83828239-83828261 CTACCCAGCACTCCCACTGCTGG + Intergenic
1194610781 X:96041041-96041063 CTCCCCTCCACTGTAAGAGCTGG + Intergenic
1196466087 X:115972924-115972946 CTCCCCACCACCCCAACAGAGGG + Intergenic
1196520672 X:116667576-116667598 CTCCCCACCCCTGCCGGAGCTGG - Intergenic
1199738529 X:150709333-150709355 CTCCCCTCCACCCCCATACCAGG + Intronic
1200239729 X:154487137-154487159 CCTCCCACCTCTCCCAGAGTGGG + Intergenic
1202627234 Y:56872208-56872230 CTTGCCCCCAGTCCCAGAGCTGG + Intergenic