ID: 1083231771

View in Genome Browser
Species Human (GRCh38)
Location 11:61326079-61326101
Sequence GTGGTAGCCCTGATAATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083231771 Original CRISPR GTGGTAGCCCTGATAATGGG GGG (reversed) Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
902270185 1:15298617-15298639 GTGATAGACATGATATTGGGTGG - Intronic
903705113 1:25279986-25280008 GCGGGAGCCCAGATAATGGATGG + Intronic
903722112 1:25413335-25413357 GCGGGAGCCCAGATAATGGACGG - Intronic
904442943 1:30543525-30543547 GTAGCAGCCTTGATAAGGGGAGG - Intergenic
909251614 1:73364145-73364167 GTGGTTGCCCTGAGGATGAGGGG - Intergenic
914940071 1:152014727-152014749 GTGGCAGCCCAGAGGATGGGAGG + Intergenic
915213823 1:154327589-154327611 ATGGAAGCCCTAGTAATGGGGGG + Intronic
916295685 1:163216782-163216804 GTGATGGCCCTGAGAAAGGGTGG + Intronic
917854773 1:179091381-179091403 GTGGTGGTCCTGAAGATGGGAGG + Intronic
920698061 1:208196790-208196812 GTGTTGTCCCTGAGAATGGGTGG + Intronic
923443752 1:234048523-234048545 GTGGTAGCCCTGATAATCTCTGG - Intronic
923956306 1:239025565-239025587 GTGGTAGGCCTGGTGATGGATGG - Intergenic
1063688198 10:8258477-8258499 GAGTTAGCCCTGAGGATGGGAGG - Intergenic
1064581398 10:16796527-16796549 GTGGGAGCTCTGATAAGAGGGGG - Intronic
1065656060 10:27951476-27951498 GTGGTATCCCAGATTATTGGAGG + Intronic
1071312230 10:84353634-84353656 GTGGTAGCCATGCTAATTGCAGG - Intronic
1072305170 10:94100322-94100344 GTGGTACCCCTGATTTAGGGAGG - Intronic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1087448674 11:98288970-98288992 GTCATAGCCCTGTTAATGGCAGG + Intergenic
1090043185 11:123308657-123308679 GTGCTGGCCCTGAAAATGAGAGG + Intergenic
1090283226 11:125476126-125476148 GTGGTTGCCCAGAGATTGGGCGG + Intronic
1091632741 12:2174161-2174183 GTGGTATCCCAGATAAATGGTGG + Intronic
1097790156 12:63806962-63806984 GTGGAAGCCCAGATTATTGGAGG - Intronic
1102381325 12:112469094-112469116 CTGGCAGACCTGATGATGGGTGG + Intronic
1105891436 13:24685204-24685226 GTAGCAGCCCTGAGGATGGGAGG - Intronic
1105986642 13:25573691-25573713 GTGGCAGCCCTGGTGCTGGGTGG + Intronic
1113925622 13:113940021-113940043 GTGGCAGCCGTGATCAGGGGAGG + Intergenic
1115845615 14:37530108-37530130 TTGGTAGCAGTGAGAATGGGAGG + Intronic
1116018817 14:39437294-39437316 GGAGTAGGCCTGACAATGGGAGG - Intergenic
1116944127 14:50820090-50820112 GTGATAGTCCTGAGAGTGGGGGG - Intronic
1120504158 14:85333776-85333798 CTGGTAGTCATGATAATGGCAGG + Intergenic
1122014251 14:98780342-98780364 GTGGAAGCCCAGATGATGTGGGG + Intergenic
1123428595 15:20194152-20194174 GTTAGAGCCCTGATAATGGGAGG - Intergenic
1124210805 15:27763757-27763779 GAGGTTGCCCTGGTACTGGGTGG + Intronic
1126450926 15:48808195-48808217 CTGGTAGCAGTGATAATGAGTGG - Intronic
1130060905 15:80569305-80569327 GTTGTAGCCCAGCTAATGGAGGG + Intronic
1140810458 16:78572224-78572246 GAGATAGCAGTGATAATGGGTGG + Intronic
1143674503 17:8422078-8422100 GTGGGAGCCCTGAGAAAAGGTGG + Intronic
1147250445 17:39150149-39150171 GTGGTCTCCCTGAAAATTGGTGG + Intronic
1147637764 17:41974376-41974398 GTGGTGGCTCTGAGAAGGGGAGG + Exonic
1148618252 17:49015635-49015657 GTGGAAGCACAGAGAATGGGGGG - Intronic
1156069554 18:33189889-33189911 GTGGTAGCCCTAATCTTGGGTGG + Intronic
1158254490 18:55530546-55530568 GAGGTGGCCCTGAAAAGGGGGGG + Intronic
1158291970 18:55953437-55953459 GTGATGGCCCTGAGTATGGGAGG + Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1165227706 19:34366061-34366083 GTGGAAGCCCTGGGAAGGGGTGG + Intronic
926181357 2:10646713-10646735 GTGGTGGCCCTGAGCAAGGGAGG - Intronic
926564047 2:14450622-14450644 CTGATAGACCTGAGAATGGGAGG + Intergenic
928031877 2:27786956-27786978 GTTGTAGCCCTGAGAATGAAGGG - Intronic
933665737 2:84963461-84963483 GTGGTATCCCAGAAAATGAGAGG + Intergenic
933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG + Intergenic
942455261 2:176133797-176133819 GTGGGAGCCCTGTGTATGGGTGG + Intergenic
947655346 2:231821897-231821919 GTGGTTGCCAGGATAATGGAGGG - Intergenic
948049417 2:234968134-234968156 GTGGTAGCAATGATAATAGATGG + Intronic
1170785533 20:19463890-19463912 GGGGCAGCCCTGGTAGTGGGTGG + Intronic
1175236282 20:57514494-57514516 GTACTGGCCCTGATACTGGGAGG - Intronic
1179068635 21:38051156-38051178 GTGGTCTCCCTGAGATTGGGAGG + Intronic
1179667511 21:42922944-42922966 AGGGTAACCCTGATAATGGCAGG - Intergenic
1182149414 22:28017829-28017851 GTGTTAGCCCTGGGGATGGGGGG - Intronic
949447894 3:4154804-4154826 GTGGTTGCCCAGATATTGGCTGG - Intronic
953517712 3:43612429-43612451 GTGGTATCCCTGAGAAAGGCAGG - Intronic
954216628 3:49128423-49128445 GTGGTAGCACTCACAATGGCAGG - Intronic
954812582 3:53257114-53257136 GTGGTAGCCATGACAATGCCAGG + Intergenic
956719985 3:72109159-72109181 GTGGTAGGCCGGATGGTGGGAGG - Intergenic
958535499 3:95398147-95398169 GAGGTAGCCCAGACAAGGGGAGG + Intergenic
963975326 3:151473865-151473887 ATGATAGCCCTTATAATTGGAGG + Intergenic
967951129 3:194841596-194841618 GTGGTAACCCTGCTACTGTGCGG + Intergenic
968634108 4:1669026-1669048 GTGGTAGTTTTGAAAATGGGAGG - Intronic
973713022 4:53648291-53648313 ATAGTAGCCATGCTAATGGGTGG + Intronic
975445000 4:74453252-74453274 GTGCTTGCACTGATAATGTGAGG + Intronic
984286147 4:177731046-177731068 GTGGTAGCCCTGGACATGGGTGG - Intronic
985591337 5:766974-766996 GTGGTCTCCCTGACAGTGGGTGG - Intergenic
990546987 5:56832562-56832584 GTGGTAGCACAGCTAGTGGGTGG + Intronic
991046124 5:62224568-62224590 GTTAGAGCCCTGATAATGGGAGG - Intergenic
1018196685 6:161361594-161361616 GTGGTATCCCTGACAGTGGTGGG + Intronic
1022185196 7:27960625-27960647 GTGGTTGCCCTGACAATTGAGGG + Intronic
1037240654 8:16773432-16773454 GTGGTAGTCATTATAATGGTAGG - Intergenic
1040661657 8:49582516-49582538 GTGGTCACCCTGATGAGGGGCGG - Intergenic
1043358492 8:79441543-79441565 GTGGTGGCCCTTAAAAAGGGGGG + Intergenic
1047085090 8:121507114-121507136 GTGGTAGCACTGAAAATTGGTGG + Intergenic
1049316566 8:141972238-141972260 GTCCCAGCACTGATAATGGGCGG + Intergenic
1055682006 9:78724872-78724894 GTGGTAGCCCTGCCACTGGAGGG - Intergenic
1058764695 9:108170196-108170218 GTAGTAGCCATTCTAATGGGTGG - Intergenic
1062478949 9:136742686-136742708 CTGGTAGCCCTGCTCCTGGGCGG + Intronic
1193393375 X:80955987-80956009 ATGGTAGCCCTTATAATCGGAGG - Intergenic
1195804026 X:108742768-108742790 GTAGTAGCCAGGACAATGGGTGG - Intergenic
1199387721 X:147242181-147242203 ATGGTAGCACTGAGACTGGGTGG - Intergenic