ID: 1083232207

View in Genome Browser
Species Human (GRCh38)
Location 11:61329952-61329974
Sequence CCTCACCTGGACATTGCCAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 288}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083232202_1083232207 -10 Left 1083232202 11:61329939-61329961 CCTAAAGCAGCCACCTCACCTGG 0: 1
1: 0
2: 0
3: 32
4: 363
Right 1083232207 11:61329952-61329974 CCTCACCTGGACATTGCCATGGG 0: 1
1: 0
2: 0
3: 34
4: 288
1083232199_1083232207 14 Left 1083232199 11:61329915-61329937 CCCTACTTAGAAAACTTTCATTG 0: 1
1: 0
2: 0
3: 20
4: 292
Right 1083232207 11:61329952-61329974 CCTCACCTGGACATTGCCATGGG 0: 1
1: 0
2: 0
3: 34
4: 288
1083232198_1083232207 30 Left 1083232198 11:61329899-61329921 CCATGAATCATGACAGCCCTACT 0: 1
1: 0
2: 2
3: 4
4: 112
Right 1083232207 11:61329952-61329974 CCTCACCTGGACATTGCCATGGG 0: 1
1: 0
2: 0
3: 34
4: 288
1083232200_1083232207 13 Left 1083232200 11:61329916-61329938 CCTACTTAGAAAACTTTCATTGG 0: 1
1: 0
2: 1
3: 19
4: 221
Right 1083232207 11:61329952-61329974 CCTCACCTGGACATTGCCATGGG 0: 1
1: 0
2: 0
3: 34
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083232207 Original CRISPR CCTCACCTGGACATTGCCAT GGG Exonic
900465868 1:2825194-2825216 CCTCACCTGGCCCTGGCCCTGGG - Intergenic
902690944 1:18109833-18109855 CCTCACCTGGACATTGCAGGGGG + Intronic
903405463 1:23091781-23091803 CCCCACCTGGATATTGCTAGTGG + Exonic
904467923 1:30718998-30719020 CCTCTCCTGGACAGTCCCGTGGG - Intronic
904893227 1:33794873-33794895 CCTCACCTAGACCTTGCTACAGG - Intronic
904893235 1:33794907-33794929 CCTCACCTAGACCTTGCTACAGG - Intronic
904893240 1:33794941-33794963 CCTCACCTAGACCTTGCTACAGG - Intronic
904893252 1:33795009-33795031 CCTCACCTAGACATTGCTACAGG - Intronic
904893259 1:33795043-33795065 CCTCACCTAGACCTTGCTATAGG - Intronic
904893266 1:33795077-33795099 CCTCACCTTGACCTTGCTACAGG - Intronic
904893272 1:33795111-33795133 CCTCACCTAGACCTTGCTACAGG - Intronic
905767097 1:40610305-40610327 CCCCACCTGGAAGCTGCCATGGG + Intergenic
906819275 1:48912457-48912479 CCTGCCCAGGACGTTGCCATTGG + Intronic
907958096 1:59251008-59251030 CCTCACCTGGAAAGTGCAAGGGG + Intergenic
910123633 1:83817405-83817427 CCTCACCTGGACACTTTCCTCGG + Intergenic
910148818 1:84115927-84115949 ACTCTCCTGGACATTGCTCTAGG - Intronic
910543246 1:88385253-88385275 ACTCTCCTGGACATTGGCCTAGG + Intergenic
911335389 1:96574911-96574933 CCACCCCTAGACATTACCATGGG - Intergenic
911492099 1:98582818-98582840 ACTCTTCTGGACATTGACATAGG - Intergenic
912079291 1:105914536-105914558 CCCCGCCTGGACACTGCCACAGG + Intergenic
912121917 1:106481666-106481688 TCTCTCCTGGACATTGGCTTAGG + Intergenic
916029836 1:160866117-160866139 ACTCTCCTGGACCTTGCCTTAGG - Intergenic
917478227 1:175387046-175387068 CCTGACCTGCACAGTGCCAGGGG - Intronic
917698393 1:177554123-177554145 ATTCATGTGGACATTGCCATAGG + Intergenic
917977702 1:180250938-180250960 CCTCACCTGGGCCTTGCCCCTGG + Intronic
918792455 1:188846776-188846798 CCCCACCTGGACACCACCATGGG - Intergenic
919849002 1:201659902-201659924 CATGCCCTGGGCATTGCCATGGG + Intronic
919931929 1:202226672-202226694 CCTCACCTGGACATTCCCTGGGG - Intronic
920346344 1:205308159-205308181 ACTCACCTTGATATTCCCATTGG + Exonic
922216388 1:223523444-223523466 CATCACCTGGACAATGCAATGGG + Intergenic
923811562 1:237323761-237323783 TCTCACCTGGACCTTTCTATTGG + Intronic
923958795 1:239053717-239053739 CATCACCTGGAACTTGCCATTGG + Intergenic
924110567 1:240695532-240695554 CCTCACTTGGCCACTGCCATTGG + Intergenic
1063190115 10:3685792-3685814 CCTCACCTGGAGAAAACCATTGG + Intergenic
1063238974 10:4149025-4149047 CCACACCTAGACACTGCCCTGGG - Intergenic
1067197790 10:44137406-44137428 CCTCACCTGGAAAGTGCAAGGGG + Intergenic
1068015870 10:51515876-51515898 TCCCACCTGGACACTGCCACGGG - Intronic
1069597419 10:69681471-69681493 CCCCACCTGGCCAGTGCCTTTGG - Intergenic
1069606024 10:69739279-69739301 CCTCACCTGCACGTGGCCAGTGG + Intergenic
1069964769 10:72105315-72105337 CCTCACCTAGACACTGCCACGGG + Intronic
1070349183 10:75575746-75575768 CCTCACCTGGAGAGTGCAAGGGG + Intronic
1070383001 10:75898470-75898492 CCTCACCTGGACTTTGCATCAGG - Intronic
1071023149 10:81082635-81082657 CCCCAGCTGAACATTCCCATTGG - Intergenic
1071525277 10:86354706-86354728 CCTCCCCGGGACCTGGCCATAGG - Intronic
1072208594 10:93225979-93226001 CCCCACCTGGGTATCGCCATGGG - Intergenic
1073117733 10:101101348-101101370 CCTCCCCTGGAAATTGTCATTGG + Intronic
1073318807 10:102601259-102601281 GCACCCCTGGACATTGCAATGGG + Intronic
1073428706 10:103472073-103472095 CCTCCCCTAGACATTCCCAGGGG - Intergenic
1073885076 10:108028825-108028847 CCTCACATGGACATCTCAATTGG + Intergenic
1074324447 10:112434959-112434981 CCTTTCCTGGTCATTCCCATGGG - Intronic
1076587289 10:131558139-131558161 CCGCACCTGGTCATGACCATTGG - Intergenic
1077185549 11:1233966-1233988 CCTCACCTGGGCTCTGCCACAGG + Intronic
1077586631 11:3458937-3458959 TCACCCCTGGACACTGCCATGGG - Intergenic
1079245956 11:18752444-18752466 CCCCACCTGGACATGGGCAGGGG + Intronic
1079769919 11:24446000-24446022 CTTCACATGGACCTTTCCATAGG + Intergenic
1080953597 11:37066312-37066334 CATCAACTAGCCATTGCCATAGG + Intergenic
1081128116 11:39343746-39343768 CTCCTCCTGGACATTGCCAGGGG + Intergenic
1082126805 11:48441936-48441958 GCTCTTCTGGACATTGCCCTAGG - Intergenic
1082135828 11:48547837-48547859 CCTCACCTGGGAAGTGCAATGGG - Intergenic
1082748641 11:56995256-56995278 CCACCCCTGGACACTACCATGGG - Intergenic
1083232207 11:61329952-61329974 CCTCACCTGGACATTGCCATGGG + Exonic
1083922750 11:65789310-65789332 CCTCACCTGGATGGTGCCAGCGG - Intronic
1084673085 11:70619066-70619088 CCTCCCCTGGGCAGGGCCATGGG - Intronic
1084687359 11:70704403-70704425 CCTCACCAGGACCTTCCCATGGG - Intronic
1084770603 11:71340615-71340637 CCTCACCGGGCCACTGTCATAGG + Intergenic
1084771551 11:71345753-71345775 CCTCACCAGGCCACTGTCATAGG + Intergenic
1084830372 11:71764035-71764057 TCACCCCTGGACACTGCCATGGG + Intergenic
1085061936 11:73455131-73455153 CCCCACCTGGACACTGCCTTGGG + Intronic
1085165718 11:74398073-74398095 CCTCAGCTGGACACGGCCATCGG - Exonic
1085870738 11:80346708-80346730 CCCCGCCTGGATATTGCCTTGGG - Intergenic
1085879281 11:80446546-80446568 CCTCACCTTCACATTGCCTTTGG + Intergenic
1086001886 11:81993335-81993357 CCACCCCTAGACACTGCCATGGG + Intergenic
1087575539 11:99984999-99985021 CCTCACCTGGGCACTGCCGCAGG - Intronic
1087602877 11:100338769-100338791 CACCACCTGGGCACTGCCATGGG - Intronic
1088127623 11:106447964-106447986 CCTTACGTGTACATAGCCATGGG + Intergenic
1089949195 11:122509730-122509752 CCACCCCTAGACACTGCCATGGG - Intergenic
1090673729 11:128970134-128970156 TCTCAACTGGACTGTGCCATAGG + Exonic
1091581031 12:1789895-1789917 CCTTACCTGGGCATAGACATTGG + Intergenic
1091792221 12:3278517-3278539 GCCAACCTGGTCATTGCCATAGG + Exonic
1092412862 12:8267670-8267692 TCACCCCTGGACACTGCCATGGG - Intergenic
1093369668 12:18352491-18352513 CCCCTCCTAGACACTGCCATGGG - Intronic
1093683580 12:22030768-22030790 CCACCCCTAGACACTGCCATGGG + Intergenic
1095120010 12:38405632-38405654 CCTCACCTGGGAAGTGCCAAGGG - Intergenic
1097257514 12:57691164-57691186 CCTCTCCAGGACATTGGCCTGGG - Intergenic
1097365759 12:58710311-58710333 CCTCACCTGGAAAGTGCAAGGGG - Intronic
1101902028 12:108798032-108798054 CCACACCTGGATGCTGCCATGGG + Intronic
1102600701 12:114027899-114027921 CCTCACATGTCCATTTCCATGGG + Intergenic
1103311441 12:120012543-120012565 CCTGACCAGGACAGTGTCATAGG - Intronic
1105794237 13:23834409-23834431 CCTCTCCTGGGCTTTGCCTTCGG + Intronic
1106352432 13:28945890-28945912 ACTCTTCTGGACATTGCCTTAGG - Intronic
1107271198 13:38619004-38619026 CGTTCCCTGGACATAGCCATGGG - Intergenic
1109138483 13:58683094-58683116 TCACCCCTAGACATTGCCATGGG - Intergenic
1110685775 13:78372410-78372432 ACTCTCCTGGACATTGTCCTAGG - Intergenic
1111558310 13:89910452-89910474 CCACACCTGGGCGCTGCCATGGG - Intergenic
1111634263 13:90882793-90882815 TCTCATGTGGACAGTGCCATAGG - Intergenic
1111636191 13:90907339-90907361 CCTCCTCTAGATATTGCCATGGG - Intergenic
1112626727 13:101113334-101113356 GCTCACCTGGACATTGAGACAGG + Intronic
1113050367 13:106204753-106204775 ACTCTTCTGGACATTGCCCTAGG - Intergenic
1115914319 14:38293879-38293901 ACTCTCCTGGACATTGGCTTAGG - Intergenic
1116125940 14:40785115-40785137 CCCCACCTGGACACTGCAGTGGG - Intergenic
1116226391 14:42158648-42158670 CCTCTTCTGGACATTGGCCTAGG + Intergenic
1117640557 14:57794127-57794149 ACTCTTCTGGACATTGGCATAGG + Intronic
1119094070 14:71812714-71812736 CCACACCTGGACAAGGCCACAGG - Intergenic
1120422732 14:84308740-84308762 GCTCACATGGACATAACCATGGG + Intergenic
1122233617 14:100319958-100319980 CCTCAGCTGGAGATAGCCAATGG - Intergenic
1122413508 14:101537853-101537875 CCTCACCTGGACACCTCCAAGGG - Intergenic
1123495904 15:20826163-20826185 ATTCACCTGGACATTGCACTTGG - Intergenic
1123552391 15:21395255-21395277 ATTCACCTGGACATTGCACTTGG - Intergenic
1123588634 15:21832652-21832674 ATTCACCTGGACATTGCACTTGG - Intergenic
1124930523 15:34115110-34115132 TCTCACCTGGACACTGCCTTGGG + Intergenic
1129891460 15:79074544-79074566 CCACACCTGGAAGGTGCCATGGG + Intronic
1130908136 15:88254118-88254140 CCTGACCTAGAGATTGCCAGGGG - Intronic
1131626876 15:94129733-94129755 ACTCTTCTGGACATTGACATAGG - Intergenic
1131686894 15:94777840-94777862 CCTAACCTGGGCATTGCAAGAGG - Intergenic
1202960738 15_KI270727v1_random:122486-122508 ATTCACCTGGACATTGCACTTGG - Intergenic
1133380157 16:5323068-5323090 CCTCACCTGCAAAATGCAATGGG + Intergenic
1133921706 16:10159335-10159357 TCTCTCCTTGACATGGCCATGGG - Intronic
1134488163 16:14675391-14675413 ACTCCCCTGGACATTGACCTAGG + Intronic
1136676009 16:31906712-31906734 CCTCACCTGGGAAGTGCAATGGG - Intronic
1137430101 16:48411721-48411743 CCTCACCTGGTCACTGCTACAGG - Intronic
1137755805 16:50901204-50901226 CCTGACCTGTGCATGGCCATGGG + Intergenic
1137834454 16:51577385-51577407 CATCACCTGGAGATTGCGAGGGG + Intergenic
1138064366 16:53925152-53925174 CCTCACATCAACATTGCCACAGG - Intronic
1138272046 16:55702373-55702395 TGTGACCTGGACATTGGCATGGG - Intronic
1138619858 16:58202277-58202299 CCTCAGTTGGTCATTGTCATTGG - Intergenic
1138849083 16:60605042-60605064 CCACCCCTAGACGTTGCCATGGG - Intergenic
1141888293 16:86908442-86908464 TCTCCCCTGGGCATTTCCATTGG - Intergenic
1142203375 16:88771582-88771604 CCTCCGCTGGACACTGTCATAGG - Intronic
1142775819 17:2138082-2138104 CCACACCTGGAAAATGCCTTTGG + Intronic
1143115562 17:4580102-4580124 CCTCTCCTGGGCACTGCCCTGGG + Intergenic
1145375424 17:22343086-22343108 TCTCTCCTGGACTTTGCCCTAGG + Intergenic
1145897854 17:28470942-28470964 CCTCTCCTGGACAGGGCTATCGG - Intronic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1146745253 17:35323327-35323349 CCCTACCTGGACTCTGCCATGGG - Intergenic
1148075772 17:44934501-44934523 CCTCACCTGGAAGATGGCATGGG + Exonic
1150072430 17:62163151-62163173 CATCACGTGGGCCTTGCCATAGG - Intergenic
1150339301 17:64353485-64353507 ACTCACCTGGACATTTCCACTGG + Exonic
1152039537 17:77894084-77894106 GCTCACCTGCACATTGTCACGGG - Intergenic
1154141194 18:11826222-11826244 CCTCCTCTGGCCCTTGCCATGGG - Intronic
1154155893 18:11943845-11943867 CCACCCCTGGACACTGCCGTGGG - Intergenic
1154364041 18:13689963-13689985 CCTCACCTGGGAAGTGCAATGGG + Intronic
1154508690 18:15069826-15069848 CCTCACTTGTACATTGACACTGG - Intergenic
1155166212 18:23234494-23234516 GCTCACCTGGTCATTTTCATCGG + Intronic
1156651616 18:39233211-39233233 CCACACCTGGATGCTGCCATGGG - Intergenic
1156713468 18:39977043-39977065 CCCCACCTAGACACTGCCACGGG - Intergenic
1157076818 18:44475824-44475846 CCCCACCTGGACAATGCCCAGGG - Intergenic
1157417030 18:47512245-47512267 CCTCTCCTGGCCAGTGCCGTCGG + Intergenic
1158014343 18:52766249-52766271 CCCCACCTGGATGCTGCCATGGG - Intronic
1159345730 18:67200899-67200921 TCACCCCTGGACACTGCCATGGG - Intergenic
1159735185 18:72087616-72087638 ACTCACCAGGAAATTGCCACTGG + Intergenic
1159777462 18:72620070-72620092 CCCCACCTGAACACTGCCGTGGG - Intronic
1163045479 19:14638399-14638421 CCTCTCCTTGACATTGGCTTTGG + Intronic
1164422779 19:28111361-28111383 ACTCTCCTGGACATTGGCCTAGG + Intergenic
1165506968 19:36239268-36239290 CCTCTCCTGCATATTTCCATGGG + Intronic
1165805807 19:38580054-38580076 CATCTCCTGGACATCGCCATGGG + Exonic
1167345404 19:48942548-48942570 CCTCACCTGTACCATGCCCTTGG - Exonic
1168343131 19:55637217-55637239 AATCACTTGGAAATTGCCATAGG + Intronic
926992816 2:18698125-18698147 CCTCACCTGGAAAGTGCAAGGGG - Intergenic
928247145 2:29640348-29640370 CCTCATGCGGACAGTGCCATGGG - Intronic
928412705 2:31066941-31066963 CCTCACCCCGACATTGCCCAGGG + Intronic
928441488 2:31295822-31295844 CCACCCCTGGACACTGCCATGGG + Intergenic
929053843 2:37859222-37859244 CCACCCCTGAACACTGCCATGGG - Intergenic
931938993 2:67231206-67231228 CCTCACCTAGATGCTGCCATAGG + Intergenic
933109163 2:78375108-78375130 CCTGACATAGACATGGCCATCGG + Intergenic
934729924 2:96650017-96650039 CCTCCCCAGAACATTACCATGGG - Intergenic
937525527 2:122764046-122764068 CCTCCCTTGCACAGTGCCATTGG - Intergenic
937616630 2:123930756-123930778 CCTCTCCTTGACATTGGCCTAGG - Intergenic
938175270 2:129120422-129120444 CCTCTTCTGGACATTGGCCTAGG - Intergenic
939614768 2:144349991-144350013 TCTCTCCTGGACATGGGCATAGG + Intergenic
941856367 2:170235149-170235171 TCCCACCTGGCCATGGCCATGGG + Intronic
943071587 2:183147274-183147296 CCTCTTCTGGACATTGGCCTAGG - Intronic
946659524 2:221984753-221984775 CCTCACCTGGGAATTGCAAGGGG + Intergenic
948419700 2:237849384-237849406 CCTCACCTGGAAAGTGCAAGGGG - Intergenic
1168750572 20:278818-278840 CCTCACCTGGGCTTTGCAAGAGG - Intronic
1173237461 20:41260413-41260435 CATCACTTGAACAATGCCATGGG + Intronic
1173307109 20:41861438-41861460 ACTCACCTGGACATGGGCAGGGG + Intergenic
1176678632 21:9805038-9805060 CCTCAGCTGGGCATTTCCAGAGG - Intergenic
1176789384 21:13301894-13301916 CCTCACTTGTACATTGACACTGG + Intergenic
1177703881 21:24674780-24674802 TCTCTCCTAGACACTGCCATGGG + Intergenic
1177988543 21:28010085-28010107 CCTCACTTGTACATTGACACTGG + Intergenic
1178222448 21:30675368-30675390 ACACACCTAGACACTGCCATGGG + Intergenic
1178447405 21:32658660-32658682 CCTCCCCTAGACACTGCCACGGG + Intronic
1179245786 21:39633038-39633060 CCTGACCTGAAGATTTCCATTGG + Intronic
1179500291 21:41804528-41804550 GCTCACCTGGACGATGCCAATGG + Exonic
1180247153 21:46555637-46555659 GCTCATCTGGGCTTTGCCATAGG + Intronic
1182512699 22:30830377-30830399 CCCCACCTGGACAGCGCCCTGGG + Intronic
1184037062 22:41923338-41923360 CCTGACCTGGACTTCGCCCTGGG - Intergenic
1184597714 22:45524344-45524366 CCTCTCCTGCTCATTGCCTTTGG + Intronic
1184860137 22:47168915-47168937 CCTCACCTGGTCTTCGGCATCGG + Intronic
1185105826 22:48869294-48869316 GATCACCTGGGCACTGCCATGGG - Intergenic
949328305 3:2891920-2891942 TCTCACCTGGATATTGGCAATGG - Intronic
950254421 3:11492860-11492882 CCCCACCTGGACACTGCCGTGGG - Intronic
950997514 3:17518818-17518840 CCCCACCTAGACACTGCTATGGG + Intronic
951251008 3:20394428-20394450 CCTTACCTGGACACTGCCACGGG + Intergenic
953580197 3:44146643-44146665 CTTCACCTGGTCATTTCTATTGG + Intergenic
954105246 3:48406262-48406284 CCTCACCTGGACGATGGAATTGG + Intronic
955063287 3:55513063-55513085 CCTCACCTGGACAGTCACAGCGG + Intronic
957505765 3:81118516-81118538 TCTCTTCTGGACATTGGCATAGG + Intergenic
959618695 3:108376813-108376835 CCTCATATGCACAATGCCATTGG - Intronic
960359758 3:116697381-116697403 CCACTCCTGGACATTGCCGTGGG - Intronic
960536048 3:118815644-118815666 CCTCACCTGTACATTCTCCTTGG + Intergenic
962387972 3:134948231-134948253 CTTCACCTGTACATTGACAGAGG + Intronic
963239824 3:142992118-142992140 CCACCCCTAGACACTGCCATGGG - Intronic
965129858 3:164683750-164683772 CTTGACCTGGACATTGCTTTAGG - Intergenic
965890852 3:173512073-173512095 CCTGACCTGGACACTCCCATGGG - Intronic
966816338 3:183893011-183893033 CCTCACCTGGACTTTGGCCTTGG - Intergenic
969001811 4:3988738-3988760 TCACCCCTGGACACTGCCATGGG - Intergenic
969214210 4:5709502-5709524 CCTAACATGGACAAGGCCATGGG + Intronic
969752194 4:9119797-9119819 TCACCCCTGGACACTGCCATGGG + Intergenic
969812103 4:9656073-9656095 TCACCCCTGGACACTGCCATGGG + Intergenic
969889234 4:10244230-10244252 CCTGTCCTGGACAATCCCATGGG + Intergenic
970131462 4:12876170-12876192 CCCTGCCTGGACGTTGCCATGGG - Intergenic
970428513 4:15966659-15966681 CCTGACCTGCACATCGCCACAGG - Intronic
970593580 4:17579585-17579607 CCCGTCCTGGACATTGCCCTGGG - Intronic
970943357 4:21661410-21661432 GCACTCCTGGACACTGCCATGGG + Intronic
971749785 4:30632216-30632238 CCCCACCTGGGCACTGCCGTGGG + Intergenic
972040800 4:34595495-34595517 CCTCTTCTGGACATTGGCATAGG - Intergenic
974710477 4:65587589-65587611 CCCCATCTGGATATTCCCATAGG + Intronic
974752342 4:66156816-66156838 ACACACCTAGACACTGCCATGGG + Intergenic
975209221 4:71679618-71679640 CCTCAGCTTGACAATGACATAGG - Intergenic
975614318 4:76231238-76231260 CATCACTTGGACATTTCCTTTGG - Intronic
981103393 4:140855030-140855052 CCACCCCTAGACACTGCCATGGG - Intergenic
981523613 4:145690551-145690573 ACTCTTCTGGACATTGCCATAGG + Intronic
981593245 4:146388811-146388833 ACTCTTCTGGACATTGACATAGG + Intronic
982652571 4:158104901-158104923 CTACACCTGGAAATAGCCATGGG - Intergenic
982652604 4:158105392-158105414 CTACACCTGGAAATAGCCATGGG + Intergenic
983362359 4:166743660-166743682 CCTCACCTGGGAAGTGCAATGGG + Intronic
984105507 4:175540866-175540888 CCCCACCTGGACGCTGCCACAGG - Intergenic
984229272 4:177074937-177074959 CCTCACCTGGGCACTGCCACAGG - Intergenic
985352847 4:189084776-189084798 CCACCCCTAGACACTGCCATGGG + Intergenic
985396928 4:189553933-189553955 CCTCAGCTGGGCATTTCCAGAGG + Intergenic
987626768 5:20412423-20412445 ACTCTTCTGGACATTGGCATAGG + Intronic
991645294 5:68795259-68795281 CCCTACCTGGACACTGCCACGGG - Intergenic
996192228 5:120559221-120559243 ACTCTCCTGGACATTGGCTTGGG - Intronic
996669506 5:126100720-126100742 CCACCTCTGGACACTGCCATGGG - Intergenic
996669653 5:126101923-126101945 CCACCCCTGGACACTGCCATGGG - Intergenic
998543415 5:143004829-143004851 TCTCACCTAGACCTTGACATTGG - Intronic
999135227 5:149314219-149314241 CCTCACTTAGCCTTTGCCATTGG + Intronic
1000563606 5:162821323-162821345 CCTCATCTGGATATTGCAAATGG - Intergenic
1001925768 5:175635593-175635615 ACTCTTCTGGACATTGGCATAGG + Intergenic
1004296440 6:14416090-14416112 CCACTCCTGGACTGTGCCATAGG + Intergenic
1006471803 6:34233868-34233890 CATTCCCTGGACATTCCCATTGG + Intergenic
1008036750 6:46753443-46753465 CCTCCCCTGTGCATTGCCACAGG - Intronic
1011408842 6:87044511-87044533 CCCCACCTGGATGCTGCCATGGG + Intergenic
1012424298 6:99097142-99097164 ACTCATCTGGACATTGGCCTAGG + Intergenic
1013113055 6:107079515-107079537 CCACCCCTAGACACTGCCATGGG + Intronic
1013259651 6:108428997-108429019 ACTCTTCTGGACATTGGCATAGG - Intronic
1015127939 6:129775083-129775105 CCTCCCCTGGAAACTGCCTTGGG + Intergenic
1015790461 6:136959677-136959699 CCCCACCTGGATGTTGCCATGGG + Intergenic
1016183072 6:141170943-141170965 CCTCCCCTAGACACTGCCACAGG - Intergenic
1016620347 6:146102192-146102214 CCTCACCAGGGTCTTGCCATTGG + Intronic
1016948699 6:149559462-149559484 CCTCTGCTGGACATTGGCCTAGG + Intergenic
1018037252 6:159892201-159892223 CCTGCCCTGTACATTCCCATCGG + Intergenic
1018107919 6:160506803-160506825 ACTCAGCTGAACATTTCCATTGG - Intergenic
1018692443 6:166358843-166358865 ACTCTCCTGGACATTGGCCTAGG - Intergenic
1022310879 7:29194823-29194845 CGTCCCCAGGACTTTGCCATGGG + Exonic
1024359711 7:48455244-48455266 TCACACCTGGACATTACCAGCGG + Exonic
1024434992 7:49341819-49341841 CCTCACCTGGAAATTGAGAAGGG - Intergenic
1024989807 7:55224272-55224294 CTTCAACTGCACATTGCCTTGGG + Intronic
1026372593 7:69716710-69716732 CATCACCTGGAACTTGCAATTGG - Intronic
1027472036 7:78585557-78585579 TCTCAGCTGCACATTGCCACTGG - Intronic
1027838207 7:83273665-83273687 CCTCTTCTGGACATTGGCCTAGG - Intergenic
1028078773 7:86548217-86548239 CCTCATCTGGGAATTGCCAGGGG - Intergenic
1028229767 7:88292574-88292596 CCAAACCAGGACATTGACATTGG + Intronic
1029258748 7:99287100-99287122 CCTCACCTGTTCCTTCCCATGGG - Intergenic
1029939962 7:104469618-104469640 CCCCACCTGGACTTAGCCCTGGG + Intronic
1031360461 7:120843551-120843573 CCTCACCTATACCTTCCCATAGG + Intronic
1033959194 7:146892230-146892252 CCTCATGTGGGCATTTCCATAGG + Intronic
1034272172 7:149808638-149808660 TCTCACCTGGACATGGCCGCAGG - Intergenic
1034468161 7:151241970-151241992 TCTCTCCTGGACAGTGGCATCGG - Exonic
1035103746 7:156423671-156423693 CATCATCTGGACATTGGCCTTGG - Intergenic
1036375408 8:8195201-8195223 TCACCCCTGGACACTGCCATGGG + Intergenic
1036854126 8:12227947-12227969 TCACCCCTGGACACTGCCATGGG - Intergenic
1036875496 8:12470447-12470469 TCACCCCTGGACACTGCCATGGG - Intergenic
1037398300 8:18467062-18467084 CCTCACCTGGGAAGTGCAATGGG + Intergenic
1039087110 8:33790671-33790693 CCTCTTCTGGACATTGGCTTAGG + Intergenic
1039672963 8:39624221-39624243 ACTCTTCTGGACATTGCCCTAGG - Intronic
1039828504 8:41194802-41194824 CCTCACCTGGACATTACTCCTGG + Intergenic
1040083933 8:43319673-43319695 CCTCAACTGAACATTGCCAAAGG + Intergenic
1040388201 8:46928300-46928322 CCTCATCTGGCCTCTGCCATTGG + Intergenic
1042019984 8:64362388-64362410 CTTCACCAGGACATTGACTTGGG - Intergenic
1043023542 8:75037133-75037155 CTTCTGCTGGACATTTCCATGGG + Intergenic
1043366397 8:79537705-79537727 CCTCACCTGGGAATTGCAAAGGG - Intergenic
1043951328 8:86312000-86312022 CCCCACCTGGGCACCGCCATGGG + Intronic
1044153603 8:88814969-88814991 ACTCTTCTGGACATTGGCATAGG + Intergenic
1044611540 8:94096914-94096936 CCTCTCCCTGACATTGCCATGGG + Intergenic
1047761771 8:127959848-127959870 CCTCACCTGTATATTGCACTTGG - Intergenic
1048135063 8:131740369-131740391 TCACCCCTAGACATTGCCATGGG + Intergenic
1048149836 8:131883697-131883719 CCTCACCTGGAAAGTGCAAAAGG - Intergenic
1048731075 8:137441736-137441758 TCACACCTGGACGCTGCCATGGG - Intergenic
1050041893 9:1504371-1504393 CCACCCCTGGACACTGCCATGGG + Intergenic
1050900804 9:10946881-10946903 TCACACCTAGACACTGCCATGGG - Intergenic
1050944418 9:11499570-11499592 CCTGCCCTAGACATTGCCACAGG + Intergenic
1052645671 9:31230446-31230468 CCTCACCTGGAAAGTGCAAGGGG - Intergenic
1052689223 9:31794671-31794693 CCTTCCCTGGGCATTGCCATTGG - Intergenic
1053580481 9:39399141-39399163 TCACCCCTAGACATTGCCATGGG + Intergenic
1053844977 9:42227219-42227241 TCACCCCTAGACATTGCCATGGG + Intergenic
1054102068 9:60957946-60957968 TCACCCCTAGACATTGCCATGGG + Intergenic
1054584290 9:66948917-66948939 TCACCCCTAGACATTGCCATGGG - Intergenic
1055201766 9:73672048-73672070 TTTCAGCTGGACATTGCCACAGG - Intergenic
1056217346 9:84417582-84417604 CCCCAGCTGGACTTTTCCATGGG + Intergenic
1058528125 9:105880095-105880117 CCTGACCTGGGCATTGGCAGTGG + Intergenic
1062191215 9:135248823-135248845 CCTCACCTGCGCATTGCCCTGGG + Intergenic
1203663799 Un_KI270754v1:7574-7596 CCTCAGCTGGGCATTTCCAGAGG - Intergenic
1186281771 X:8000718-8000740 CCACACCTGGATAATGACATAGG + Intergenic
1186810267 X:13181508-13181530 CCTCACCTGGAAAGTGCAAGGGG + Intergenic
1187485711 X:19701280-19701302 TCTCACCTGGAAATAGCAATGGG - Intronic
1188080378 X:25831741-25831763 ACTCTTCTGGACATTGCCGTAGG - Intergenic
1188688967 X:33105346-33105368 ACTCTCCTGGACATTGGCCTAGG + Intronic
1190060263 X:47206314-47206336 CACCACCTGCACATTGCCTTTGG - Exonic
1192209820 X:69120617-69120639 CCCCACCTGGCCATTCCTATCGG - Intergenic
1194068229 X:89288135-89288157 TCACCCCTGGACACTGCCATGGG - Intergenic
1195261002 X:103131588-103131610 CCTCACCTGGGAAGTGCAATGGG + Intergenic
1195853169 X:109305198-109305220 CCCCACCTGGGCATCACCATAGG - Intergenic
1196873094 X:120131210-120131232 CCCCACCTGGACAATGCCACAGG - Intergenic
1198486910 X:137096359-137096381 CCTCATCTGGCCATTGGAATAGG - Intergenic
1199080294 X:143569215-143569237 TCTCAGCTGGAAATTGCCATAGG - Intergenic
1199449338 X:147962035-147962057 CCTTATCTGGAGATTGGCATGGG - Intergenic
1199827531 X:151515377-151515399 CCCCATCAGGACATTGTCATAGG - Intergenic
1200060465 X:153481577-153481599 CTTCATCTTGACATTGCCACAGG - Intronic
1200722371 Y:6622305-6622327 TCACCCCTGGACACTGCCATGGG - Intergenic
1201308218 Y:12569764-12569786 CCTCACCTGGAAAGTGCAAAGGG + Intergenic
1201355651 Y:13094397-13094419 CCTCATCTGTTCATTTCCATAGG - Intergenic