ID: 1083237331

View in Genome Browser
Species Human (GRCh38)
Location 11:61359791-61359813
Sequence CAGGTGGGTTACCTGAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77522
Summary {0: 2, 1: 68, 2: 2089, 3: 21817, 4: 53546}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083237325_1083237331 -1 Left 1083237325 11:61359769-61359791 CCAGCACTTTGGGAGGCCCAGGC 0: 2180
1: 139656
2: 236493
3: 200747
4: 123380
Right 1083237331 11:61359791-61359813 CAGGTGGGTTACCTGAAGTCAGG 0: 2
1: 68
2: 2089
3: 21817
4: 53546
1083237318_1083237331 26 Left 1083237318 11:61359742-61359764 CCAGCACAGTGATTCATGCCTGT 0: 2
1: 25
2: 341
3: 1241
4: 3326
Right 1083237331 11:61359791-61359813 CAGGTGGGTTACCTGAAGTCAGG 0: 2
1: 68
2: 2089
3: 21817
4: 53546
1083237321_1083237331 8 Left 1083237321 11:61359760-61359782 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1083237331 11:61359791-61359813 CAGGTGGGTTACCTGAAGTCAGG 0: 2
1: 68
2: 2089
3: 21817
4: 53546
1083237323_1083237331 0 Left 1083237323 11:61359768-61359790 CCCAGCACTTTGGGAGGCCCAGG 0: 3560
1: 212195
2: 267615
3: 175700
4: 97562
Right 1083237331 11:61359791-61359813 CAGGTGGGTTACCTGAAGTCAGG 0: 2
1: 68
2: 2089
3: 21817
4: 53546

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083237331 Original CRISPR CAGGTGGGTTACCTGAAGTC AGG Intronic
Too many off-targets to display for this crispr