ID: 1083240674

View in Genome Browser
Species Human (GRCh38)
Location 11:61385829-61385851
Sequence ACAGGTACTGAGAGTGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083240672_1083240674 -4 Left 1083240672 11:61385810-61385832 CCGGTTATCATGGAACAGAACAG No data
Right 1083240674 11:61385829-61385851 ACAGGTACTGAGAGTGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083240674 Original CRISPR ACAGGTACTGAGAGTGAATC TGG Intergenic
No off target data available for this crispr