ID: 1083244958

View in Genome Browser
Species Human (GRCh38)
Location 11:61419735-61419757
Sequence CATTGTGCTGGGAGTCAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083244958_1083244961 7 Left 1083244958 11:61419735-61419757 CCTACTTGACTCCCAGCACAATG 0: 1
1: 0
2: 0
3: 17
4: 150
Right 1083244961 11:61419765-61419787 TTCTATATAGACCTATTCTGAGG 0: 1
1: 0
2: 1
3: 11
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083244958 Original CRISPR CATTGTGCTGGGAGTCAAGT AGG (reversed) Intronic
903216363 1:21845639-21845661 CAAAGTGCTGGGATTCAGGTGGG + Intronic
904295340 1:29516643-29516665 CTGTGTGTTGGGAGTGAAGTGGG + Intergenic
909302642 1:74032754-74032776 CATAGTCCTGGGAATCAAGGAGG + Intronic
911391027 1:97243513-97243535 CATGGTGTTGGGAGTCAGGTAGG - Intronic
914956415 1:152166774-152166796 CATAGTGCTGGGACCCCAGTAGG + Intergenic
915514581 1:156405465-156405487 AATTGGGCTGGGCTTCAAGTGGG - Intronic
915655186 1:157353419-157353441 CATTTTGCTGGGAGCTGAGTTGG + Intergenic
916637915 1:166693609-166693631 CAGTTTGCTGGAATTCAAGTGGG + Intergenic
918629129 1:186694709-186694731 GATTGTGTTTGGAGACAAGTAGG - Intergenic
919623821 1:199891446-199891468 CATTGTTTTGGTAGCCAAGTAGG - Intergenic
920768693 1:208858952-208858974 CAGTGTGGTTGGAGTAAAGTGGG + Intergenic
920849139 1:209616841-209616863 CATTGTCCTGGGAGTGAGGTGGG - Intronic
921343562 1:214158460-214158482 CAGTATTCTGGGAGCCAAGTGGG - Intergenic
922614690 1:226954902-226954924 CAGGGTGCTGGGAGGCATGTTGG + Intronic
924101999 1:240613379-240613401 CAATGTGCTGTGAGTTGAGTTGG - Intergenic
1062826202 10:570743-570765 TAGTGTGCTGGGAGCAAAGTAGG - Intronic
1062879556 10:966931-966953 CAGTGTTCTGAGAGCCAAGTGGG - Intergenic
1063267201 10:4466247-4466269 CTTTGTGCTGGGAGTCAGAGGGG - Intergenic
1066986130 10:42468538-42468560 CATTGTGCTAGGAGTTATGGTGG - Intergenic
1067051784 10:43025576-43025598 CATTCTGCTGGGACTGCAGTGGG - Intergenic
1069057611 10:63861033-63861055 CATTCTGCTGTCAGTCAACTGGG + Intergenic
1069831078 10:71282740-71282762 CCTTGTGCAGGGAGTCCAGATGG - Intronic
1074219665 10:111424065-111424087 CATTGTGATAGGAGCCAAGAAGG - Intergenic
1074455169 10:113589975-113589997 CAATGTGCTGTGAGTCCAGCCGG + Intronic
1076269877 10:129142842-129142864 AATTGCGCTGGAAGTCTAGTGGG + Intergenic
1076564926 10:131392166-131392188 CATTCTCCTGGGAGCCACGTGGG - Intergenic
1077444131 11:2582432-2582454 CATAGGGCTGGGAATCCAGTGGG + Intronic
1078360455 11:10663790-10663812 CATTGTGCTGGGTGTGTAGTAGG - Intronic
1082913701 11:58407319-58407341 CATCATGTTGGGAGTCATGTTGG + Intergenic
1083244958 11:61419735-61419757 CATTGTGCTGGGAGTCAAGTAGG - Intronic
1085350950 11:75797618-75797640 CATTTTGCTGGGAGACCAGGAGG + Intronic
1085499911 11:77010634-77010656 CATTGTGCTGGGTATCCAGTGGG - Intronic
1085876726 11:80416407-80416429 CACTGTGCTGGGAATACAGTGGG + Intergenic
1088971297 11:114776591-114776613 CTTCGTGCTGGGAGCCCAGTGGG + Intergenic
1089679011 11:120109172-120109194 CATTGAGCTTGGTGTCAGGTTGG - Intergenic
1092623560 12:10301127-10301149 CATTGTGCTGCAAGCCTAGTTGG - Intergenic
1092708552 12:11309804-11309826 CAATGTGCTGGGAGTGGAATGGG - Intronic
1096571560 12:52526326-52526348 CCTTGGACTGGGAGACAAGTAGG - Intergenic
1098027205 12:66216260-66216282 CATTGTCCTGGGAGCCAGATGGG - Intronic
1098270201 12:68762510-68762532 CATTCTGCCTGGAGTAAAGTGGG + Intronic
1100632996 12:96406858-96406880 GATGGTCCTGGGAGTCATGTAGG - Intergenic
1101184853 12:102265124-102265146 CAGTATTCTGGGAATCAAGTTGG + Intergenic
1101193686 12:102361001-102361023 TATTGTGCTGGAAAGCAAGTGGG + Intergenic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1106242717 13:27923436-27923458 TATTGTTCTGGGGGTCACGTTGG - Intronic
1107959857 13:45548110-45548132 CCTTGGGCTGGGAGTCAAGATGG + Intronic
1116134793 14:40908579-40908601 CAGTATTCTGGGAGTAAAGTTGG + Intergenic
1117085288 14:52194616-52194638 CACTGAGCTGGGAGTCCAGAGGG + Intergenic
1118258919 14:64229500-64229522 CATTGTGGTGGGAGGTAAGGGGG + Intronic
1119105595 14:71920382-71920404 CATTGTGAGGGGAGTCAAGATGG + Intergenic
1120864104 14:89280866-89280888 CTTTGTGCTTGGTGTCAAATAGG - Intronic
1121180598 14:91925902-91925924 CACTGTACTGGGTGTCAAGCAGG - Intronic
1125651684 15:41322175-41322197 CATAGTGCTGGGATTACAGTAGG - Intronic
1125979695 15:43989214-43989236 CATTGTGCTGGGCGCCAGGGTGG + Intronic
1125981276 15:44003541-44003563 TATTGTGTTTGGAGTAAAGTAGG - Intronic
1130459783 15:84152477-84152499 CACTCAGCTGGGAGTCAGGTGGG - Intergenic
1130805343 15:87314964-87314986 CATTGTGTTAGGAGGCAAGTAGG - Intergenic
1131844162 15:96471090-96471112 CATTGTGATGGGAGTCGTGCAGG + Intergenic
1133893481 16:9903504-9903526 CCTTGTGTTTGGTGTCAAGTAGG - Intronic
1134238604 16:12487204-12487226 CATTGGGCTGGTAGTGAAGTGGG + Intronic
1138824432 16:60302010-60302032 CAGTCTGCTGGGAGACAAGAGGG + Intergenic
1140445331 16:75022849-75022871 CCTTGTGCTGAGAGTCTAGGAGG + Intronic
1143137368 17:4719399-4719421 CATGGTGCTGGAAGCCAGGTTGG - Exonic
1143344768 17:6241543-6241565 CATTGTGAGGGGAGTCAACAGGG - Intergenic
1143514001 17:7410411-7410433 CATTGTACTGGGGGGCACGTGGG - Intronic
1144465422 17:15493246-15493268 CCCTGTGCTGGGAGTCCATTGGG + Intronic
1146917812 17:36689335-36689357 CATAATGCTGGGAGCCAAGCCGG - Intergenic
1146936537 17:36815701-36815723 CTCTGGGCTGGGAGTCAAGGTGG + Intergenic
1151702943 17:75752985-75753007 CTTTGTGCTGGGAATCAAGGAGG - Intronic
1152270694 17:79323010-79323032 CATTGTGCTGGGGGACATGAAGG + Intronic
1152769889 17:82161157-82161179 CATCCTGGTGGGAGTGAAGTGGG - Intronic
1153499547 18:5734100-5734122 CATTGTTATAGCAGTCAAGTAGG - Intergenic
1154259309 18:12815890-12815912 CTTTGTGCTGGCAGTCATGGTGG + Intronic
1165380345 19:35474945-35474967 CATTGAACTGGAAATCAAGTTGG + Intergenic
1167715135 19:51138173-51138195 AAATGTGCTGGGAGCCCAGTGGG - Intergenic
926147244 2:10404303-10404325 CAGTGTGCTGGGAGGCAAAAGGG - Intronic
927518909 2:23687712-23687734 CATTGTCCGGGCAGACAAGTGGG + Intronic
930893622 2:56420874-56420896 CATAGTGCTGGGAGTACAGGTGG + Intergenic
931705376 2:64942505-64942527 CATTGTTCTGGGAGTGCACTGGG + Intergenic
934108088 2:88714656-88714678 CCATGGCCTGGGAGTCAAGTAGG + Intronic
934674512 2:96240105-96240127 CATTGTGCAGAGGGTTAAGTGGG + Intergenic
934712134 2:96523137-96523159 CATGGAGCTGGGAGTCCCGTGGG + Intergenic
935535922 2:104294679-104294701 CTTTGTGCTGGGGGTGAGGTGGG - Intergenic
942956381 2:181779010-181779032 CAATGTGCTGGGAGACTAGCAGG + Intergenic
944694464 2:202188701-202188723 GAATCTGCTGGGAGTCAAATAGG - Intronic
946411356 2:219516828-219516850 CATTGTGCAGGGAGAAGAGTCGG + Intronic
947074508 2:226327765-226327787 CAATCTGCTGGCAGCCAAGTGGG - Intergenic
947484960 2:230539639-230539661 CATGGGTCTGGGAGCCAAGTAGG - Intronic
948554976 2:238803077-238803099 CCCAGTGCTGGGAGTCAGGTGGG + Intergenic
948838629 2:240638111-240638133 CATGGTGCTGGGAGCCAGGAGGG - Intergenic
1170103235 20:12725516-12725538 CATAGAACTGAGAGTCAAGTGGG - Intergenic
1170499129 20:16956727-16956749 GATTGTGCTAGAAGTCAAGAGGG + Intergenic
1173124295 20:40322299-40322321 CATGGAGCTTGCAGTCAAGTAGG - Intergenic
1174662656 20:52227641-52227663 AATTGTGGTGGGAGGCAAGGAGG - Intergenic
1175381167 20:58565510-58565532 CACAGCGCTGGGATTCAAGTAGG + Intergenic
1179305469 21:40149974-40149996 CATTGTGGTGGCATTCATGTTGG - Intronic
1179647764 21:42785597-42785619 GATTGTGCTGGGGGACAAGGGGG + Intergenic
1179668116 21:42926358-42926380 CATTGTGCCTGGCCTCAAGTGGG + Intergenic
1179831284 21:43998275-43998297 GAATCTGCTGGGAGTCAAGAGGG - Intergenic
1181482175 22:23207144-23207166 CATTGTGCTTGGACCCCAGTAGG - Intronic
1182056460 22:27359184-27359206 CATGGAGCTGGGAGTCTAATGGG + Intergenic
950163982 3:10779925-10779947 CATTGTGCTGGCTGTGAAGATGG - Intergenic
950674555 3:14546756-14546778 CATTTTGAGGAGAGTCAAGTGGG - Intergenic
950773878 3:15333114-15333136 CATTGAGCTGGGATTTAAGGAGG + Intronic
952763419 3:36935092-36935114 AATTGTGCTGGGAGGCAGATGGG - Intronic
953653841 3:44832247-44832269 CAAGGTGCTGGCAGTGAAGTGGG + Intronic
954412723 3:50378049-50378071 CATGGTGCTGGCAGGCAAGGAGG - Exonic
954634144 3:52062492-52062514 AACTCTGCTGGGAGCCAAGTTGG + Intergenic
956105018 3:65808559-65808581 CATTGTGCTGGAAGTAAATGAGG - Intronic
958585158 3:96077678-96077700 TATTGTCCTGGGAGTTAAGTGGG - Intergenic
961802867 3:129466189-129466211 CATTGAGCTGGTAAACAAGTAGG - Intronic
963662740 3:148148361-148148383 AACTGTGCTGGGAGTCAGATTGG - Intergenic
963984884 3:151580817-151580839 AATTCTGCTAGGAATCAAGTTGG - Intergenic
966516007 3:180821444-180821466 CATTGTGCTGGGAGCCAGGGTGG - Intronic
967951262 3:194842724-194842746 CATTTTGCTAGAAGTCAATTGGG + Intergenic
970687426 4:18584397-18584419 TCTTGTGCTGGGAGTCAAAGTGG - Intergenic
972656229 4:41066388-41066410 CATGGTGCTGGGTGTATAGTAGG - Intronic
973565121 4:52177986-52178008 CATTTTCCTGGGAGTCTAGAAGG + Intergenic
974853292 4:67429318-67429340 CTTTGTTCTGGGAAGCAAGTTGG - Intergenic
975879837 4:78891378-78891400 CATTGTGCTGGGGACCTAGTGGG + Intronic
979299716 4:119073629-119073651 CATTCAGCTGGGAGCCAAGATGG + Intergenic
985164778 4:187081859-187081881 CAATGTGCCTGGAGTCAAGTAGG - Intergenic
985849176 5:2375997-2376019 AACTGTGCTGAGAGTCAGGTGGG + Intergenic
986199190 5:5565991-5566013 TGTTGTGCTGGAAGTCTAGTAGG - Intergenic
991313226 5:65269487-65269509 CATTGTCACGGGAATCAAGTGGG - Intronic
991335186 5:65539481-65539503 TATTGTGTTGGGAGTTAATTGGG - Intronic
991713883 5:69433718-69433740 CAAAGTGCTGGGATTCAGGTGGG + Intronic
992338562 5:75798758-75798780 CACTGTGCAGGGAGCCAAGATGG - Intergenic
993545606 5:89208822-89208844 CATTCAACTGTGAGTCAAGTAGG - Intergenic
995705264 5:114982306-114982328 CATTTTGCTGGGGTTCATGTTGG - Intergenic
998512834 5:142728014-142728036 CTTTGTGCTGGGACCCCAGTTGG - Intergenic
1002924557 6:1597499-1597521 CATGGTGTTGGGAGTCACGGAGG + Intergenic
1004976509 6:20973413-20973435 CAGTGAGCGGGGAGTGAAGTAGG + Intronic
1008726806 6:54431453-54431475 CATTGAGTTGGGAGTCAAGGGGG + Intergenic
1010334737 6:74667168-74667190 CATTGTCCTGGAAGCCAAGAGGG - Intergenic
1011882789 6:92051792-92051814 CTTAGTGCTGTGAGTCAAATAGG + Intergenic
1012832858 6:104227702-104227724 CTTTCTGCTGGGAGTGAAGTGGG - Intergenic
1014364745 6:120525259-120525281 CATTGTGCTGGTTTTCAAGGGGG + Intergenic
1018985249 6:168631356-168631378 CAGTGTGCTGGGTTTGAAGTAGG + Intronic
1019222446 6:170484577-170484599 GATTTTGCTTGGACTCAAGTGGG + Intergenic
1019313648 7:374820-374842 CTCTGTGCTGGGGGTCACGTGGG + Intergenic
1019390601 7:784451-784473 GATTCTGCTGGGAGTTAAGAGGG - Intronic
1020023393 7:4882767-4882789 CCTTTTGCTGGGGGGCAAGTCGG - Intronic
1021297252 7:18923316-18923338 CATTAGACTGGGAGTCAAGCTGG - Intronic
1027975182 7:85144801-85144823 CATTGGGCTGGGATTAAAGTAGG - Intronic
1029331057 7:99855850-99855872 CATTTTGCTGGGAATAAAGAAGG + Intronic
1032843725 7:135735361-135735383 GATTGTGCTAGGAATCAAGTGGG + Intronic
1032885980 7:136138786-136138808 CATTGTGCTGGGAGTGTGGATGG + Intergenic
1033829261 7:145232721-145232743 CATTGGGATGGAAGTCAAATTGG - Intergenic
1037346620 8:17907815-17907837 CTTTGTTCAGGGACTCAAGTGGG + Intronic
1037347626 8:17916344-17916366 CTTTGTTCAGGGACTCAAGTGGG + Intergenic
1038802599 8:30762774-30762796 AACTGTGCTGGGAGTTATGTGGG - Intronic
1044370330 8:91402871-91402893 CATGGTGCTGGGAGGCAAGATGG + Intergenic
1050326470 9:4502551-4502573 CATTGTACTGAGGGTCAAATGGG - Intronic
1051466894 9:17389551-17389573 CATTGTACTGTATGTCAAGTTGG + Intronic
1051522827 9:18009400-18009422 CACTGTGCTGTGAGGCAAATAGG - Intergenic
1052773145 9:32707781-32707803 CAAGGAGCTTGGAGTCAAGTTGG + Intergenic
1056489135 9:87087718-87087740 CATAGTGCTGGGTGCCAAATAGG + Intergenic
1059065876 9:111083119-111083141 CATTGTCTTTGGAGTCAAATAGG + Intergenic
1059775111 9:117466438-117466460 CAATGTGGAGGGGGTCAAGTAGG - Intergenic
1061179173 9:129013883-129013905 CAGTGAGCTGGGAGTGAAGGGGG + Intronic
1188549776 X:31350265-31350287 CATTGATCTGGGAGAGAAGTGGG - Intronic
1195130578 X:101847069-101847091 GATTGTCCTTGGAATCAAGTAGG + Intronic
1196051261 X:111307758-111307780 CAGTGTGCTGGGACTCAAAGTGG - Intronic
1196194752 X:112827959-112827981 CATTTATCTGGGAGTCAAATTGG - Intronic
1196925898 X:120632628-120632650 CATGGAGCTGTCAGTCAAGTGGG + Intergenic
1198434483 X:136602847-136602869 CATGGAGCTTGGAGTCAAATAGG - Intergenic
1199808904 X:151329552-151329574 CAGTGTTCTGGGAGCCAAGAGGG + Intergenic