ID: 1083246210

View in Genome Browser
Species Human (GRCh38)
Location 11:61429923-61429945
Sequence GGCGGCGGCGGCGGCGAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3086
Summary {0: 1, 1: 8, 2: 94, 3: 434, 4: 2549}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083246191_1083246210 18 Left 1083246191 11:61429882-61429904 CCAACCTGCCCCCGACCGCGCGC 0: 1
1: 0
2: 0
3: 23
4: 205
Right 1083246210 11:61429923-61429945 GGCGGCGGCGGCGGCGAGTCCGG 0: 1
1: 8
2: 94
3: 434
4: 2549
1083246205_1083246210 -7 Left 1083246205 11:61429907-61429929 CCGTTACCGGGAATATGGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1083246210 11:61429923-61429945 GGCGGCGGCGGCGGCGAGTCCGG 0: 1
1: 8
2: 94
3: 434
4: 2549
1083246192_1083246210 14 Left 1083246192 11:61429886-61429908 CCTGCCCCCGACCGCGCGCCCCC 0: 1
1: 1
2: 8
3: 139
4: 1216
Right 1083246210 11:61429923-61429945 GGCGGCGGCGGCGGCGAGTCCGG 0: 1
1: 8
2: 94
3: 434
4: 2549
1083246190_1083246210 19 Left 1083246190 11:61429881-61429903 CCCAACCTGCCCCCGACCGCGCG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1083246210 11:61429923-61429945 GGCGGCGGCGGCGGCGAGTCCGG 0: 1
1: 8
2: 94
3: 434
4: 2549
1083246199_1083246210 3 Left 1083246199 11:61429897-61429919 CCGCGCGCCCCCGTTACCGGGAA 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1083246210 11:61429923-61429945 GGCGGCGGCGGCGGCGAGTCCGG 0: 1
1: 8
2: 94
3: 434
4: 2549
1083246189_1083246210 23 Left 1083246189 11:61429877-61429899 CCGGCCCAACCTGCCCCCGACCG 0: 1
1: 0
2: 1
3: 20
4: 309
Right 1083246210 11:61429923-61429945 GGCGGCGGCGGCGGCGAGTCCGG 0: 1
1: 8
2: 94
3: 434
4: 2549
1083246204_1083246210 -6 Left 1083246204 11:61429906-61429928 CCCGTTACCGGGAATATGGCGGC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1083246210 11:61429923-61429945 GGCGGCGGCGGCGGCGAGTCCGG 0: 1
1: 8
2: 94
3: 434
4: 2549
1083246196_1083246210 7 Left 1083246196 11:61429893-61429915 CCGACCGCGCGCCCCCGTTACCG 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1083246210 11:61429923-61429945 GGCGGCGGCGGCGGCGAGTCCGG 0: 1
1: 8
2: 94
3: 434
4: 2549
1083246201_1083246210 -4 Left 1083246201 11:61429904-61429926 CCCCCGTTACCGGGAATATGGCG 0: 1
1: 0
2: 0
3: 1
4: 10
Right 1083246210 11:61429923-61429945 GGCGGCGGCGGCGGCGAGTCCGG 0: 1
1: 8
2: 94
3: 434
4: 2549
1083246195_1083246210 8 Left 1083246195 11:61429892-61429914 CCCGACCGCGCGCCCCCGTTACC 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1083246210 11:61429923-61429945 GGCGGCGGCGGCGGCGAGTCCGG 0: 1
1: 8
2: 94
3: 434
4: 2549
1083246187_1083246210 30 Left 1083246187 11:61429870-61429892 CCCTCTTCCGGCCCAACCTGCCC 0: 1
1: 0
2: 1
3: 14
4: 274
Right 1083246210 11:61429923-61429945 GGCGGCGGCGGCGGCGAGTCCGG 0: 1
1: 8
2: 94
3: 434
4: 2549
1083246193_1083246210 10 Left 1083246193 11:61429890-61429912 CCCCCGACCGCGCGCCCCCGTTA 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1083246210 11:61429923-61429945 GGCGGCGGCGGCGGCGAGTCCGG 0: 1
1: 8
2: 94
3: 434
4: 2549
1083246194_1083246210 9 Left 1083246194 11:61429891-61429913 CCCCGACCGCGCGCCCCCGTTAC 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1083246210 11:61429923-61429945 GGCGGCGGCGGCGGCGAGTCCGG 0: 1
1: 8
2: 94
3: 434
4: 2549
1083246202_1083246210 -5 Left 1083246202 11:61429905-61429927 CCCCGTTACCGGGAATATGGCGG 0: 1
1: 0
2: 0
3: 0
4: 11
Right 1083246210 11:61429923-61429945 GGCGGCGGCGGCGGCGAGTCCGG 0: 1
1: 8
2: 94
3: 434
4: 2549
1083246188_1083246210 29 Left 1083246188 11:61429871-61429893 CCTCTTCCGGCCCAACCTGCCCC 0: 1
1: 0
2: 4
3: 26
4: 395
Right 1083246210 11:61429923-61429945 GGCGGCGGCGGCGGCGAGTCCGG 0: 1
1: 8
2: 94
3: 434
4: 2549

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083246210 Original CRISPR GGCGGCGGCGGCGGCGAGTC CGG Intronic