ID: 1083247351

View in Genome Browser
Species Human (GRCh38)
Location 11:61439491-61439513
Sequence ATTCTGTTATCGATGAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083247346_1083247351 27 Left 1083247346 11:61439441-61439463 CCATAAGGAAAAATAATATAGTC 0: 1
1: 0
2: 7
3: 46
4: 415
Right 1083247351 11:61439491-61439513 ATTCTGTTATCGATGAAAACTGG 0: 1
1: 0
2: 0
3: 6
4: 139
1083247349_1083247351 -7 Left 1083247349 11:61439475-61439497 CCCAGCTGTGTTGGAGATTCTGT 0: 1
1: 0
2: 2
3: 21
4: 181
Right 1083247351 11:61439491-61439513 ATTCTGTTATCGATGAAAACTGG 0: 1
1: 0
2: 0
3: 6
4: 139
1083247348_1083247351 0 Left 1083247348 11:61439468-61439490 CCATCTGCCCAGCTGTGTTGGAG 0: 1
1: 0
2: 3
3: 22
4: 235
Right 1083247351 11:61439491-61439513 ATTCTGTTATCGATGAAAACTGG 0: 1
1: 0
2: 0
3: 6
4: 139
1083247350_1083247351 -8 Left 1083247350 11:61439476-61439498 CCAGCTGTGTTGGAGATTCTGTT 0: 1
1: 0
2: 3
3: 17
4: 235
Right 1083247351 11:61439491-61439513 ATTCTGTTATCGATGAAAACTGG 0: 1
1: 0
2: 0
3: 6
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083247351 Original CRISPR ATTCTGTTATCGATGAAAAC TGG Intronic
907986836 1:59540332-59540354 ATTCTATTATTGATGGGAACTGG - Intronic
908039857 1:60100309-60100331 ATTCTGTTATTGATAGACACTGG + Intergenic
909856355 1:80537771-80537793 ATTCTGTTAGTGAAGAAGACAGG - Intergenic
911737489 1:101353730-101353752 ATGATGTTATGGATAAAAACTGG - Intergenic
916339184 1:163709870-163709892 ATTTTGTTATTGTGGAAAACTGG + Intergenic
916583587 1:166130151-166130173 AATGTGTCATCCATGAAAACAGG + Intronic
917294080 1:173501087-173501109 TTTCTTTTATAGTTGAAAACTGG - Exonic
917461348 1:175233158-175233180 GTTCTGTTATCAAGGAAAAAGGG - Intergenic
924313308 1:242769599-242769621 ATTTTGTTAGAGATGAAGACTGG + Intergenic
1064222356 10:13452256-13452278 ATGCTGTCATATATGAAAACCGG - Intronic
1070092874 10:73305757-73305779 ATTTTATCATCGTTGAAAACTGG - Intronic
1071200275 10:83214314-83214336 ATTCTGGTGTTCATGAAAACCGG + Intergenic
1071898440 10:90091196-90091218 GTCCTGTTACAGATGAAAACAGG - Intergenic
1072366211 10:94712497-94712519 ATTCTGTTATTTGTGATAACAGG - Intronic
1073591380 10:104760926-104760948 TTTGTTTTATCGAAGAAAACAGG + Intronic
1074499991 10:114014549-114014571 ATGCTGTTTTCAATGGAAACTGG + Intergenic
1074768344 10:116716829-116716851 ACTCTGTTATCAATGAACACAGG + Intronic
1080495502 11:32814196-32814218 ATTCAGTTATCTATGGAACCAGG + Intergenic
1080875132 11:36267818-36267840 ATTCTTTAATCCATGGAAACTGG + Intergenic
1081361983 11:42191177-42191199 ATTATGTTATTGATCAGAACAGG + Intergenic
1083247351 11:61439491-61439513 ATTCTGTTATCGATGAAAACTGG + Intronic
1086763677 11:90666851-90666873 ATTTTGTTAGCGATGAAGAAGGG - Intergenic
1087455039 11:98374094-98374116 TTTCTGTTGTGGAAGAAAACTGG - Intergenic
1087554559 11:99699477-99699499 ATTTTATTATGGATGAAAATGGG + Intronic
1088836386 11:113581000-113581022 ATTCAGTTATGGATTAAAAGGGG - Intergenic
1089521100 11:119064186-119064208 ATGCGGTTATTGACGAAAACTGG + Intergenic
1091941090 12:4483061-4483083 ATTCTGTCGTCGATTAAATCTGG - Intergenic
1092220917 12:6712822-6712844 ATTCAAATATTGATGAAAACTGG - Intergenic
1098244162 12:68499174-68499196 CTTCAGTTATTGATGAAAATAGG + Intergenic
1100891217 12:99128225-99128247 TTTATTTTATAGATGAAAACTGG + Intronic
1103841055 12:123864645-123864667 ATTCTGTGATGGATGACAACAGG + Exonic
1106024607 13:25945061-25945083 AGTGTGTCATTGATGAAAACAGG + Intronic
1106646654 13:31641755-31641777 ATTCTGCTATTTATGACAACTGG + Intergenic
1108084253 13:46768430-46768452 ATTCTGTTATAGATGGATTCAGG + Intergenic
1108339386 13:49482770-49482792 CTTATGGTATTGATGAAAACGGG + Exonic
1109236026 13:59821762-59821784 AAACTGTTATCAATGAAAATAGG + Intronic
1109589689 13:64462523-64462545 ATTCTGATATGGACAAAAACAGG + Intergenic
1111194096 13:84850104-84850126 ATCCCGTTAGCGATGAAAGCTGG - Intergenic
1111490406 13:88965775-88965797 ATTCTTTTATTGATGGAAACAGG + Intergenic
1111895547 13:94137316-94137338 AATCTATTATTGATGAGAACAGG + Intronic
1116705294 14:48288514-48288536 ATTATGTTATCAATTAAAATTGG + Intergenic
1118756887 14:68851395-68851417 ATTTTGTTATCTCTGAAATCTGG + Intergenic
1120733520 14:88028514-88028536 AATCTGTTATCGCTGGACACAGG + Intergenic
1121925981 14:97927803-97927825 CTTCAGTTAGTGATGAAAACAGG - Intronic
1123983776 15:25626119-25626141 CTTCAGTTAAGGATGAAAACAGG - Intergenic
1124932833 15:34138782-34138804 ATTCTGTTATAGAATAAAAAAGG + Intergenic
1126463396 15:48937819-48937841 ATTCTGTGTTCTCTGAAAACAGG + Intronic
1129141128 15:73598862-73598884 ATACTGCTATGGATGTAAACAGG - Intronic
1132302327 15:100783835-100783857 GTTCTTTTATGGATGAGAACAGG + Intergenic
1133576915 16:7100453-7100475 ATTCTGTTTTGGAGGAAAATGGG - Intronic
1138228058 16:55315888-55315910 AATCTGTATTCAATGAAAACAGG - Intergenic
1139076934 16:63462980-63463002 ATTCTGTGATCGATAAGAAAAGG + Intergenic
1140247138 16:73261579-73261601 ATTCTGTTTTCCAAGAAAATTGG + Intergenic
1140929488 16:79614007-79614029 GTTCTGTTACAGATGAAAACAGG + Intergenic
1145355401 17:22141957-22141979 ATAATGTTATCTATGAAACCAGG + Intergenic
1149125059 17:53219207-53219229 ATTCTGTCATTTATGACAACAGG - Intergenic
1150562612 17:66306572-66306594 ACTTTGTTCTCGATGACAACTGG - Intronic
1150681336 17:67286886-67286908 ATTCTTTTATACATGTAAACTGG + Intergenic
1153657841 18:7301208-7301230 ATTTTGTTGTTGTTGAAAACTGG + Intergenic
1156630020 18:38955905-38955927 ACTCAGTTGTCCATGAAAACTGG - Intergenic
1165565100 19:36718936-36718958 ATTCTTTTCTAGAAGAAAACTGG + Exonic
1166018030 19:39997839-39997861 ATTCTGCTATTCATCAAAACAGG + Exonic
925995930 2:9293088-9293110 ATTCTGTTATTTAAAAAAACTGG - Intronic
928504994 2:31941911-31941933 ATTCTGATATTGATTAAAAACGG + Intronic
933476010 2:82791045-82791067 ATTCTGTTCTCCAGGAAAATAGG - Intergenic
937163787 2:119793298-119793320 TTTCTCTTATTGCTGAAAACGGG - Intronic
937816303 2:126254408-126254430 ATTCTACTATTGAGGAAAACTGG - Intergenic
938699926 2:133867098-133867120 ATTCTGTTAACCATAGAAACTGG + Intergenic
938858533 2:135341628-135341650 TTTCTCTTATTGCTGAAAACGGG + Intronic
939325794 2:140686560-140686582 ATACTTTTATTGATGAAAATAGG + Intronic
939624446 2:144459873-144459895 ATTCTCTCATAGAGGAAAACAGG + Intronic
939751864 2:146057996-146058018 ATTCTGCTATCAATGGACACTGG + Intergenic
940992627 2:160113426-160113448 TTTGTATTATCTATGAAAACAGG + Intronic
941531024 2:166671516-166671538 ATTGTTTTATGGATGAAAAAAGG + Intergenic
944447508 2:199806196-199806218 ATTGTTTTATCTATGAAAAATGG + Intronic
1175002940 20:55649502-55649524 GTACTGTTATCCATGGAAACTGG - Intergenic
1178083094 21:29085965-29085987 ATCCTGTTTTCAGTGAAAACAGG + Intronic
1180261529 21:46673045-46673067 ATTCATTTGTTGATGAAAACGGG - Intergenic
1184506556 22:44907249-44907271 TTTCTGTTATGGCTGAAATCAGG + Intronic
949521415 3:4858021-4858043 ATGCTGTTCTAGAAGAAAACAGG - Intronic
949700194 3:6747450-6747472 AATCTGTTATCTCTGAAAGCAGG - Intergenic
949844670 3:8357434-8357456 ATTATGTTCTAGGTGAAAACTGG - Intergenic
950612776 3:14136948-14136970 TTTCTGTTGTTGATGAACACAGG + Intronic
951277062 3:20700651-20700673 ATTCTGTTATAGCTCAAATCTGG + Intergenic
951820716 3:26808048-26808070 ATTCTCTTCTTGATAAAAACAGG - Intergenic
952647184 3:35674675-35674697 ATTCTGATAGCTATGAAAAATGG + Intronic
955664405 3:61335226-61335248 ATTCTGTTACCCAAAAAAACTGG - Intergenic
956175383 3:66468361-66468383 ATTCTGTTAATGTTGAAAAATGG - Intronic
958619106 3:96533588-96533610 TTTCTGTTATTGTTGAAAACTGG - Intergenic
960566650 3:119139769-119139791 ATGCTGTTATCTTTTAAAACAGG - Intronic
961118165 3:124349553-124349575 ACTCTGTTATCAATTAAACCAGG - Intronic
962493340 3:135915325-135915347 ATTCTGTTAGCTATGAAGAATGG - Intergenic
964081229 3:152760478-152760500 ACTATGTTATCTACGAAAACAGG - Intergenic
967115200 3:186331321-186331343 ATTCAGTTATCTGTGAAATCAGG - Intronic
974212884 4:58804664-58804686 ATTCTGTTTTCTAAGAAAAAAGG - Intergenic
975624581 4:76332018-76332040 ATTCAATTATTGATGAAAATAGG + Intronic
979041344 4:115801032-115801054 TTTGTGTTATCTATGAAAGCAGG + Intergenic
979651070 4:123132549-123132571 ATTCTTCTATCAATGAACACTGG - Intronic
980483338 4:133419211-133419233 ATGCTGTTATAGATGTAAAGAGG + Intergenic
981469058 4:145108797-145108819 ATTTTGTTATACATTAAAACTGG + Intronic
981767433 4:148267026-148267048 ATTCTGTTATCTACAAAAATAGG - Intronic
982477023 4:155866263-155866285 ATACTGTTATTGATGAAAATTGG - Exonic
982487192 4:155980241-155980263 ATTCTATTATGGATGCACACAGG - Intergenic
984448525 4:179869151-179869173 AATCTGTTATGTATGAAAGCAGG - Intergenic
984991429 4:185385129-185385151 ATTCTGTGATCAAATAAAACAGG + Intronic
986157047 5:5186674-5186696 ATTATTTTATCTATAAAAACAGG + Intronic
986908463 5:12524142-12524164 TTTCTGTTTTTGATGAATACTGG + Intergenic
987735627 5:21839245-21839267 ATTTTGTTATTAAGGAAAACAGG - Intronic
992825438 5:80545514-80545536 ATTCTCTTACTGATGAAAATTGG - Intergenic
999581027 5:153038096-153038118 ATTCTCTCATCTATGAAAAGAGG - Intergenic
1002703634 5:181145586-181145608 ATCCTGTTACAAATGAAAACAGG - Intergenic
1006548829 6:34803258-34803280 AGTCTGTTAGGGTTGAAAACTGG + Intronic
1010499945 6:76585569-76585591 AATCTGTTATCGCTGAAAGTGGG + Intergenic
1013693838 6:112677021-112677043 AGTCTGTTATTGATGGACACTGG - Intergenic
1016680962 6:146828910-146828932 TTGCTGTTATCGAACAAAACTGG - Intergenic
1020478511 7:8627817-8627839 TTTCTTTTATGGATGAAATCTGG - Intronic
1021665498 7:22974148-22974170 ACTCTGTTATCGACTAAAATGGG - Intronic
1022208877 7:28189031-28189053 ATTATTTTATAGATGAAGACTGG - Intergenic
1023104871 7:36754017-36754039 TTTCTGTTTTTGATGAAAATTGG - Intergenic
1024537380 7:50449589-50449611 ATTCTGTTCTTGATGCAAAACGG + Exonic
1024537393 7:50449713-50449735 CTTCTTTTATAGGTGAAAACCGG - Exonic
1027396186 7:77756833-77756855 ACTCTTTTATCGATTAAAAATGG - Intronic
1030472610 7:109985345-109985367 ATTCTGTTTTTTATGAAAGCAGG - Intergenic
1033164076 7:139023693-139023715 ATTCTATTAAAGATTAAAACAGG + Intergenic
1034890970 7:154838902-154838924 ACCCTGTTCACGATGAAAACTGG - Intronic
1036703527 8:11029891-11029913 CTTCTGTTATGGATGGAAAATGG - Intronic
1039980215 8:42403289-42403311 GTTTTCTTATCTATGAAAACAGG + Exonic
1040573636 8:48631336-48631358 ATACTGCTATAGATGAACACTGG - Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1042337311 8:67641779-67641801 ATTGTATCATCTATGAAAACTGG - Intronic
1046702319 8:117415103-117415125 ATTCTGTTGTCTAGGGAAACTGG + Intergenic
1047385227 8:124403073-124403095 ATTCTGTTAGCCTTGAAAAGTGG + Intergenic
1057132177 9:92661757-92661779 GTTTTGGTATTGATGAAAACTGG - Intronic
1057538526 9:95941724-95941746 ATTCTGAGATGGATGAAAAATGG - Intronic
1058363434 9:104178166-104178188 ATTCTTCTATCGATGGACACAGG + Intergenic
1059115321 9:111596076-111596098 TTTCAGTTATCAATGAAAGCAGG + Intronic
1187458589 X:19465338-19465360 ATTCTATTATCCCTGAAAATAGG + Intronic
1189587043 X:42472670-42472692 ATTATGTTATTAATAAAAACAGG + Intergenic
1190450893 X:50579708-50579730 ATTCTGTGATGGAAGATAACTGG + Intergenic
1191616516 X:63175857-63175879 ATTTTGTAATCGATGTAAATGGG - Intergenic
1191619781 X:63203066-63203088 ATTTTGTAATCGATGTAAATGGG + Intergenic
1194779150 X:98001925-98001947 ACTCTGTTCTAGAAGAAAACAGG + Intergenic
1195561013 X:106284027-106284049 ATTCTGGTTTCTATGACAACTGG - Intergenic
1196377112 X:115045475-115045497 ATTCTGTTAATTATCAAAACAGG + Intergenic
1200972536 Y:9169307-9169329 ATTTTGTTAACGCTGAAAAAGGG + Intergenic
1202138484 Y:21694944-21694966 ATTTTGTTAACGCTGAAAAAGGG - Intergenic