ID: 1083251684

View in Genome Browser
Species Human (GRCh38)
Location 11:61472118-61472140
Sequence CCATACACAAAGGTGGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083251671_1083251684 3 Left 1083251671 11:61472092-61472114 CCTGCTTCTCCCTTCCCACCCCC 0: 1
1: 0
2: 14
3: 233
4: 1944
Right 1083251684 11:61472118-61472140 CCATACACAAAGGTGGAGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 111
1083251672_1083251684 -6 Left 1083251672 11:61472101-61472123 CCCTTCCCACCCCCACGCCATAC 0: 1
1: 0
2: 2
3: 64
4: 590
Right 1083251684 11:61472118-61472140 CCATACACAAAGGTGGAGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 111
1083251673_1083251684 -7 Left 1083251673 11:61472102-61472124 CCTTCCCACCCCCACGCCATACA 0: 1
1: 1
2: 7
3: 70
4: 619
Right 1083251684 11:61472118-61472140 CCATACACAAAGGTGGAGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083251684 Original CRISPR CCATACACAAAGGTGGAGTA GGG Intronic
900536476 1:3180313-3180335 ACGTACACACAGGTGGAGTGAGG + Intronic
900996557 1:6126294-6126316 CCATACCCAGAGGTGGAGGGTGG - Intronic
901292348 1:8133885-8133907 CCAAACAGAAGGGTGGAGAATGG - Intergenic
901326767 1:8371342-8371364 CTATACACTAAGATGGAGTTAGG + Intronic
904351174 1:29907749-29907771 CCATTCACAAATGTGTATTAAGG - Intergenic
904797954 1:33071579-33071601 ACATACACAAAGAGGGAGAAAGG + Intronic
905310582 1:37046262-37046284 CCAGTCAGAAAGGTGGGGTAGGG + Intergenic
909608436 1:77530108-77530130 ACATACACAAAGTTTGAGTCTGG + Intronic
909669180 1:78168895-78168917 CAATACACAGTGGTGGAGCAGGG + Intergenic
911755383 1:101548239-101548261 CCAGAAACAAAGGTGGCATAGGG - Intergenic
912705166 1:111906105-111906127 CCATTCTCAAGGGTGGTGTAGGG + Intronic
914931823 1:151941783-151941805 CCAAACACAAAGGAGGAGTGTGG - Intergenic
916449538 1:164906876-164906898 CCATGCACAATGGTAGAGTGAGG - Intergenic
916589603 1:166177452-166177474 CCCTGCACTAAGGTGGAGTTAGG - Intergenic
918059408 1:181048594-181048616 GCACACACAGAGGTGGAGTGGGG + Intronic
919284974 1:195545614-195545636 CCATATTCAAATGTGAAGTATGG + Intergenic
921053059 1:211524808-211524830 CCAGACACAAGTGTGGAGCAGGG - Intergenic
921256080 1:213340845-213340867 CCAATCACACAGGTGGAGTCAGG - Intergenic
921618020 1:217294607-217294629 CCATACAGAAGGGTAGAATACGG + Intergenic
1065841549 10:29705428-29705450 CCATACAGAAAGGAGGCGGAGGG + Intronic
1073828072 10:107348844-107348866 CCATACACTAAGATGGAGCAGGG - Intergenic
1083251684 11:61472118-61472140 CCATACACAAAGGTGGAGTAGGG + Intronic
1084613492 11:70219097-70219119 CCTTACAGAAAGGTGGAGAAGGG + Intergenic
1084613518 11:70219218-70219240 CCCTCCAGAAAGGTGGAGAAGGG + Intergenic
1089396977 11:118142555-118142577 CCATACACAGAAGAGGAGGAAGG + Intronic
1093329785 12:17821765-17821787 CCTTACAAAAAGGTGCAGTAGGG - Intergenic
1094711602 12:32968995-32969017 CCATTCAGAAAGGTGGTGCAGGG + Intergenic
1095734940 12:45546595-45546617 ACATAAACAAACATGGAGTAGGG + Intergenic
1099923406 12:88986777-88986799 CCATACTCAAGAGTGGAGTAGGG + Intergenic
1101014399 12:100484615-100484637 GCATACAAAAAGGAGGAGGAAGG - Intronic
1101440097 12:104697402-104697424 TCAAACAAAAAGGTGGAGGAAGG + Intronic
1104315260 12:127693056-127693078 CAATACTCAAAGTTGGACTAAGG - Intergenic
1104509418 12:129363044-129363066 CAATAAACAAAGATGGAGGAAGG - Intronic
1105995744 13:25670211-25670233 TCATACAAAATGGTGGAGTAGGG - Intronic
1110438591 13:75502905-75502927 CCACACTCAGAGGTGGAGGATGG + Intergenic
1114340029 14:21733627-21733649 CCTTACAAAAAGGGGGAATATGG - Intergenic
1116031351 14:39576682-39576704 CCATACACAAAGGTGGGAGATGG - Intergenic
1117100244 14:52338559-52338581 CCCTACACCAGGGTGGAGGATGG - Intergenic
1117980068 14:61334130-61334152 CCACACACTGAGGTGGAGTCGGG - Intronic
1118656960 14:67961514-67961536 CCATACACATAGCTTGAGGAAGG + Intronic
1119555952 14:75552705-75552727 CCAGACAGAAAGGAGGAGAAAGG - Intergenic
1127965564 15:63920362-63920384 CCATGCAGAAAGGGGGAGCAAGG - Intronic
1132122238 15:99186065-99186087 AGATACAGAAAGGTGCAGTAAGG - Intronic
1134897396 16:17900815-17900837 TCATACATAAAGGTGGCGTGTGG - Intergenic
1138719327 16:59060564-59060586 ACAGACAAAAAGGTGGAGGAAGG + Intergenic
1139125643 16:64073058-64073080 CTCTAAACAAAGGTGGAGAAAGG - Intergenic
1144163900 17:12588915-12588937 GCCTACACAAGGGTGGAGGAAGG + Intergenic
1148194988 17:45706868-45706890 CCATACACCACAGTGGAGTCAGG - Intergenic
1149853686 17:60059082-60059104 CCTTACACATAGGTAGAGGATGG - Intronic
1153264708 18:3258743-3258765 CAACACAGAAAAGTGGAGTATGG + Intergenic
1153373912 18:4354295-4354317 CCACACAGCAAGGTGGAGGAAGG - Intronic
1159327534 18:66942505-66942527 ACATACACACACGTGTAGTACGG + Intergenic
1160600642 18:80010158-80010180 ACAGACACAAAGGTGAAGTTGGG + Intronic
1166854583 19:45777258-45777280 CCCTCCATAAAGTTGGAGTAAGG - Intronic
1167374122 19:49102152-49102174 CCATACACTGAGGTGTTGTAAGG - Intronic
1168284326 19:55322889-55322911 GAATACACAAAGCTGGAGGAAGG - Intronic
926363220 2:12109798-12109820 CCTTATACAAAGGTGGAATTTGG - Intergenic
928168139 2:28985590-28985612 CGATACACAAAGGTGGGGGCAGG + Intronic
929875395 2:45792472-45792494 CCAAACACAAAGCTAGAGAAGGG + Intronic
933094189 2:78157471-78157493 ACACAGACACAGGTGGAGTAAGG - Intergenic
933206983 2:79517957-79517979 CCAAACAGGGAGGTGGAGTAAGG + Intronic
935488023 2:103682085-103682107 TAAGACACAAAGGTGGAATAAGG + Intergenic
935950737 2:108326125-108326147 CCAATTACAAAGGTGGAGTCTGG + Intergenic
936239781 2:110777508-110777530 CCATACACAGCTGTGGAGTTGGG - Intronic
941605849 2:167595476-167595498 ACATACACACATGTGGAGGAAGG - Intergenic
943788338 2:191902737-191902759 CCATGCACAAAAGTTTAGTATGG + Intergenic
944890414 2:204111268-204111290 CCATACACATAGTTGGAGATAGG - Intergenic
945425468 2:209695258-209695280 CCATCCAAAAAGGTGGAACAAGG + Exonic
1170472860 20:16685634-16685656 ACATGCACAAAGATGGAGTCAGG - Intergenic
1182654906 22:31882040-31882062 CCAGCAACAAAGGTGGAGTGGGG + Intronic
1185119660 22:48958422-48958444 CCATTCACAAAGATGAACTAAGG + Intergenic
957548435 3:81670908-81670930 CCATACAAAAAACTGGATTATGG - Exonic
957988720 3:87604372-87604394 CCATTCACAAAGGGGAAGAATGG - Intergenic
959760351 3:109955760-109955782 CTATAAACAAATGTGGAGAAAGG - Intergenic
963556724 3:146799457-146799479 GCACACACAATGATGGAGTATGG - Intergenic
965705922 3:171508076-171508098 TCAAACACAAAGGTGGATGAAGG - Intergenic
971961470 4:33493056-33493078 CCACAGACTAGGGTGGAGTAGGG + Intergenic
972895123 4:43610471-43610493 ACACTCACAAAGCTGGAGTATGG - Intergenic
974235376 4:59174042-59174064 ACACACACAAAAGTGCAGTATGG - Intergenic
975056368 4:69936111-69936133 CCTTACACAAAGAAGGAGTAGGG + Intronic
975895155 4:79079983-79080005 ACCTACCCAAAGGTGGAGCATGG - Intergenic
979065083 4:116121451-116121473 CCATACACAAAGGTAGATACCGG + Intergenic
982302628 4:153895444-153895466 CAATACACAAAAGTGGGGGAAGG - Intergenic
986920245 5:12671594-12671616 ATATACACAAGGGTGGAGGAGGG - Intergenic
990748904 5:58990627-58990649 AGATACAGAAAGGTGGAGTGTGG - Intronic
990970788 5:61503509-61503531 TCATACACAAAGGAAGACTATGG - Intronic
998349324 5:141490744-141490766 ACATACACAAAGGAGGAGGCTGG - Exonic
1000202310 5:159023557-159023579 CAATACACTATGGTGGAGGAAGG - Intronic
1002166315 5:177349476-177349498 CCAAATAGAAAGGTGGAGGAAGG + Intronic
1003427661 6:6008499-6008521 GCATAGACAAAGGGGGAGAAAGG + Intergenic
1005495915 6:26387943-26387965 CCATCCATCAAGGTGCAGTAGGG + Intronic
1007005223 6:38355923-38355945 TCATATACGAAGGTGGACTAAGG - Intronic
1007831414 6:44641624-44641646 CAATAGACAAAGCTGGAGTTTGG - Intergenic
1008661088 6:53668651-53668673 CCATACACTATGTTGGAGAATGG - Intergenic
1013403257 6:109819206-109819228 TCATTCAGAAAGGAGGAGTATGG + Intronic
1013674329 6:112440656-112440678 TCAGACACCAAGGTGGAGGATGG + Intergenic
1018092940 6:160361230-160361252 CCATGTACAAAGGTGGACTCAGG + Intronic
1022547331 7:31201265-31201287 CCATTTACAAAGGTAGAGCAGGG + Intergenic
1022557070 7:31308766-31308788 CCACACACAATGGTGGGGTGTGG + Intergenic
1024644679 7:51361192-51361214 CATGACAAAAAGGTGGAGTAGGG - Intergenic
1030942024 7:115663253-115663275 CCAGAAAGAAAGGAGGAGTATGG + Intergenic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034735172 7:153422284-153422306 GCATACACAGATGTGGAGTGAGG + Intergenic
1036094759 8:5711543-5711565 CCAAAAACAAAGGTAGAGAAAGG - Intergenic
1036392254 8:8333805-8333827 CCTTACTCAAAGTTGGAGAATGG - Intronic
1038349760 8:26765268-26765290 CCAGACCCAAATGTGGAGGAGGG - Intronic
1039487799 8:37925302-37925324 TCATCCACAAAGGTAGAGTAAGG - Intergenic
1039770347 8:40680261-40680283 CCATACTGAAAGCTGGAGTTAGG - Intronic
1041559115 8:59194569-59194591 ACAACAACAAAGGTGGAGTAGGG - Intergenic
1048080983 8:131126751-131126773 GCACACACTAAGGTGGAATAAGG - Intergenic
1048737232 8:137515346-137515368 GCATAGACAAAGGTGGAAAATGG - Intergenic
1049459546 8:142718352-142718374 CCAGCCACAGAGGTGGAGTGGGG + Intergenic
1053442918 9:38130685-38130707 CCATACTCAGAGGTGGAGGTTGG + Intergenic
1058282681 9:103135898-103135920 ACATTCACAAAGGTTGAGAAAGG - Intergenic
1059388155 9:113981330-113981352 CCTTACACAGAGGGGGAGCAAGG - Intronic
1059576525 9:115494924-115494946 CCATACACAGAGGTACACTATGG - Intergenic
1194723209 X:97364647-97364669 CCATACCATAAGGTAGAGTAGGG - Intronic
1196245921 X:113400364-113400386 CCATACTCAAAGGTTGAGGGTGG + Intergenic
1197153471 X:123245237-123245259 GCAGACACATAGGTGGAGGATGG + Intronic
1198370343 X:135983627-135983649 ACATAAACAGAGGTGGAGTCTGG + Intergenic
1201273639 Y:12279248-12279270 CCATACACAAGGATGAAATATGG + Intergenic