ID: 1083252475

View in Genome Browser
Species Human (GRCh38)
Location 11:61477358-61477380
Sequence TCCTGCCCATGTTACATGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 313}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083252475_1083252481 24 Left 1083252475 11:61477358-61477380 CCTCACATGTAACATGGGCAGGA 0: 1
1: 0
2: 1
3: 36
4: 313
Right 1083252481 11:61477405-61477427 GGGAGTGAAAAGCGATGATGAGG 0: 1
1: 0
2: 0
3: 9
4: 169
1083252475_1083252476 3 Left 1083252475 11:61477358-61477380 CCTCACATGTAACATGGGCAGGA 0: 1
1: 0
2: 1
3: 36
4: 313
Right 1083252476 11:61477384-61477406 TAGTAGTTCCCACGTAGAGCCGG 0: 1
1: 0
2: 0
3: 2
4: 32
1083252475_1083252477 4 Left 1083252475 11:61477358-61477380 CCTCACATGTAACATGGGCAGGA 0: 1
1: 0
2: 1
3: 36
4: 313
Right 1083252477 11:61477385-61477407 AGTAGTTCCCACGTAGAGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083252475 Original CRISPR TCCTGCCCATGTTACATGTG AGG (reversed) Intronic
900932941 1:5748027-5748049 CCGAGCCCATTTTACATGTGGGG - Intergenic
901303869 1:8218316-8218338 TCCTCCCCAGGCTACCTGTGGGG - Intergenic
901527290 1:9831650-9831672 TTTTGCCCATTTTACAGGTGAGG - Intergenic
902311089 1:15582374-15582396 TCATTCCCATCTTACAGGTGAGG + Intronic
903067720 1:20710070-20710092 TCATGCCCATTTTACAGATGTGG - Intronic
903228601 1:21907925-21907947 TCGTGCCCATTTTACACATGAGG - Intronic
903391706 1:22968760-22968782 TCGTCCCCATTTTACAGGTGAGG - Intergenic
903491513 1:23732247-23732269 TCTTGCACATCTTACATTTGAGG + Intergenic
903853650 1:26322676-26322698 TACTCCCCATTTTACAGGTGAGG - Intronic
904403499 1:30272158-30272180 TTCTGCCCATGTTTGCTGTGTGG + Intergenic
905903442 1:41597537-41597559 TCATTCCCATTTTACAGGTGAGG + Intronic
906024745 1:42664007-42664029 TCTTCCCCATTTTTCATGTGAGG - Intronic
906702859 1:47872450-47872472 TGCTGCCCCTGTTCCTTGTGGGG - Intronic
907481725 1:54749536-54749558 TCCTGCTCATGTTGCAGATGAGG - Intergenic
907574044 1:55509895-55509917 TCCAACCCATTTTACAGGTGAGG + Intergenic
907757924 1:57328823-57328845 ATCTGCCCATGTGGCATGTGAGG + Intronic
908577225 1:65473202-65473224 TCCTGCACATTTTACAGGTGAGG + Intronic
908590506 1:65627131-65627153 GCCTGTCCATGTAACATCTGTGG + Intronic
910435496 1:87201632-87201654 TCATCCCCATTTTACAGGTGAGG - Intergenic
911831868 1:102560449-102560471 TCCTGTCCTGGGTACATGTGTGG + Intergenic
912706699 1:111920156-111920178 TCCTGCCAATGTTCCATCTGGGG + Intronic
912975995 1:114330798-114330820 TCCTGCCCATTTTATAAGCGTGG + Intergenic
913053319 1:115135588-115135610 TCATTCCCATTTTACAGGTGAGG - Intergenic
913697669 1:121343470-121343492 TCCTACCCAGGTTAGATGTAAGG + Intronic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
916394031 1:164365715-164365737 TGCTGCCCATATTCCATGTGAGG - Intergenic
918573569 1:186027542-186027564 TCCTTCCCATTTTACAGATGAGG - Intronic
919905975 1:202078522-202078544 TCCTTCCCATTTTCCATATGGGG + Intergenic
919992536 1:202718484-202718506 TCATGCCCATTTTACAGATGAGG - Intergenic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
920689203 1:208132851-208132873 TTATGCCCATTTTACAGGTGAGG + Intronic
922030784 1:221795614-221795636 ACCACCCCGTGTTACATGTGAGG + Intergenic
922093753 1:222423179-222423201 TCCTGCCAATGCTACATCTCTGG + Intergenic
922469670 1:225868299-225868321 TTGTGCCCAAGTTACGTGTGTGG + Intronic
922485932 1:225972939-225972961 TCATCCCCATTTTACAGGTGAGG - Intergenic
924549222 1:245059051-245059073 TCATCCCCATTTTACAGGTGTGG + Intronic
1063070328 10:2656047-2656069 TTATTCCCATGTTACAGGTGAGG - Intergenic
1063916668 10:10889911-10889933 TCCTGTGCATGATAAATGTGGGG + Intergenic
1066087628 10:31986305-31986327 TCATGTCCATGTTACAGATGAGG - Intergenic
1066296909 10:34061940-34061962 TCCACCTCATGTTACATTTGTGG + Intergenic
1066587102 10:36947619-36947641 TTATGCCCATTTTACATTTGAGG + Intergenic
1067205375 10:44207944-44207966 TCATGCCTATTTAACATGTGAGG - Intergenic
1067339155 10:45387131-45387153 TCATCTCCATTTTACATGTGAGG + Intronic
1067552351 10:47244808-47244830 GCCTGCCCCTCCTACATGTGGGG + Intergenic
1070379093 10:75863575-75863597 TCATCCCCATTTTACAGGTGAGG - Intronic
1072163416 10:92789044-92789066 TCCTTCCCATTTTACAAGGGAGG - Intergenic
1072662692 10:97372419-97372441 TCGTGCCCATTTTACAGATGAGG + Intronic
1073513034 10:104054412-104054434 TCCTGACCATGTTAGTGGTGGGG - Intronic
1073606706 10:104902797-104902819 TTATGCCCATGTTAGATATGGGG + Intronic
1073942807 10:108717775-108717797 TCCTGCCCAAGATATATGGGAGG - Intergenic
1074856747 10:117479612-117479634 TCCTGCCCATTTTACAGATGAGG + Intergenic
1074966498 10:118495386-118495408 TCCTGCCCATGTTTAAGGGGAGG - Intergenic
1075159213 10:120008641-120008663 TCCTGCCCATTTTAAAGATGAGG - Intergenic
1075441877 10:122486233-122486255 TCCTTCCCATATTATATATGGGG - Intronic
1075471106 10:122690226-122690248 TCCTGGATATGTTAAATGTGAGG - Intergenic
1075553569 10:123412433-123412455 TTATGCCCATATTACAGGTGAGG + Intergenic
1075629009 10:123988734-123988756 TAATGCCCATGTTTCATGGGAGG + Intergenic
1076092496 10:127699885-127699907 TCCTGGCCATGTTCTTTGTGCGG - Intergenic
1077197425 11:1288407-1288429 TCCTGCCCATGTTCTCTGTCTGG - Intronic
1078511201 11:11985413-11985435 TCATGCCCATTTTACAGATGAGG - Intronic
1078858759 11:15228215-15228237 TCATGCCCATTTTACAGATGAGG - Intronic
1078964796 11:16326413-16326435 TCCTGCCTATGTGACATGGAGGG - Intronic
1079394017 11:20045946-20045968 TCATCCCCATTTTACAGGTGAGG - Intronic
1079755424 11:24253508-24253530 TCCAGCCACTGTGACATGTGGGG - Intergenic
1080642968 11:34168571-34168593 TCCTCCCCATTTTACAGCTGAGG + Intronic
1080692352 11:34568810-34568832 CCCTGCCCATTTTACAGGGGAGG - Intergenic
1081546142 11:44073291-44073313 TCATACCCATGTTGCAGGTGAGG - Intronic
1081810536 11:45911613-45911635 TCATCCCCATCTTACAGGTGAGG + Intronic
1082766648 11:57173889-57173911 TCATGCCCATTTTAGATATGAGG + Intergenic
1083171452 11:60925858-60925880 TCCTGCCCCTTTTACAAGTGAGG + Intronic
1083252475 11:61477358-61477380 TCCTGCCCATGTTACATGTGAGG - Intronic
1084386670 11:68847259-68847281 TCTTTCCCATGTTACAGATGAGG - Intergenic
1084539761 11:69778558-69778580 TCATGCCCATTTTACAGATGGGG - Intergenic
1084561170 11:69906238-69906260 TTCTGCTCATGTTACAGGTGAGG - Intergenic
1084679092 11:70655440-70655462 TCCTCCCCATTTTACAGATGGGG - Intronic
1084877083 11:72140971-72140993 TTCTGCTCATCTTACAGGTGGGG + Intergenic
1084882240 11:72179753-72179775 TTCTGCTCATCTTACAGGTGGGG + Intergenic
1085577187 11:77616836-77616858 TCCTCCCCATTTTACAGATGGGG + Intronic
1085723723 11:78935458-78935480 CTCTGCCCATTTTACAGGTGAGG + Intronic
1086310375 11:85529877-85529899 TCCTGCCATAGTTTCATGTGAGG - Intronic
1088503448 11:110507089-110507111 GCATGCCCATTTTACATGTGAGG + Intergenic
1089342504 11:117768016-117768038 CCTTGCCCATTTTACAGGTGAGG - Intronic
1089362104 11:117897852-117897874 TCCTGCCAATGGGACATGGGAGG - Intergenic
1089659202 11:119975073-119975095 TCATGACCATTTTACATGTGAGG + Intergenic
1089988414 11:122835208-122835230 TTCTTCCCATTTTACAAGTGAGG + Intergenic
1090364086 11:126191861-126191883 AACTGCCCATTTTACAGGTGAGG + Intergenic
1090478981 11:127051131-127051153 TTATGCCCATGTTACAGATGCGG + Intergenic
1090484669 11:127102326-127102348 TTCTCCCCATTTTACAGGTGAGG - Intergenic
1090810359 11:130234896-130234918 TACTGTCCATGTTGCCTGTGGGG - Intronic
1091283266 11:134394305-134394327 TCGTCCCCATTTTGCATGTGAGG + Intronic
1091856832 12:3747244-3747266 TCCTCCCCATTTTACAGATGAGG - Intronic
1092892631 12:12982967-12982989 TCATGCCCATCTTACAGATGAGG + Intronic
1094348567 12:29498074-29498096 TCCTGCCTGTGTTTCGTGTGGGG - Intergenic
1095413007 12:41945254-41945276 TCCTGCCCATGTTCAAAGGGAGG + Intergenic
1096079589 12:48824798-48824820 TCCTGCCCAAGTGAACTGTGTGG + Intronic
1096481334 12:51943201-51943223 TCATTCCCATGTTACAGATGAGG + Intergenic
1097905995 12:64920169-64920191 TCCAGCCCATAGTGCATGTGCGG - Intergenic
1100396943 12:94193873-94193895 TCCTGCCCATGTTGCCAGTGTGG - Intronic
1101328445 12:103737519-103737541 TACTGGCCATGTTACATGGCTGG + Intronic
1102000003 12:109551436-109551458 TCCTCCCCATTTCACAGGTGAGG - Intergenic
1102259934 12:111437549-111437571 TCATCCCCATTTTACAGGTGAGG + Intronic
1102558285 12:113743314-113743336 TTCTTCCCATTTTACAGGTGAGG - Intergenic
1104594471 12:130111675-130111697 TCTTCTCCATTTTACATGTGAGG + Intergenic
1106154231 13:27137712-27137734 TCCTGCCCATATTCCAGGGGAGG - Intronic
1106629884 13:31460283-31460305 TATTGCCCATGTTACATGGCAGG + Intergenic
1108066352 13:46581583-46581605 TCATCCCCGTGTTAGATGTGAGG + Intronic
1109842440 13:67937119-67937141 TTTTCCCCAAGTTACATGTGAGG - Intergenic
1110343569 13:74419733-74419755 ACCTGCCCAGGTAACTTGTGTGG - Intergenic
1113176033 13:107564973-107564995 TCCTGCCCATGTTTCAAGTGGGG - Intronic
1113314818 13:109167410-109167432 TCCTGCTTATGTAACATTTGGGG + Intronic
1113875595 13:113592731-113592753 TCCTGCCCAGGTGACAGGTGTGG + Intronic
1113875612 13:113592811-113592833 CCCTGCCCAGGTGACAGGTGTGG + Intronic
1113875653 13:113593051-113593073 CCCTGCCCAGGTGACAGGTGTGG + Intronic
1113875749 13:113593525-113593547 CCCTGCCCAGGTGACAGGTGTGG + Intronic
1114415423 14:22539747-22539769 TTTTGCCCATTTTACAGGTGAGG + Intergenic
1114803462 14:25806160-25806182 TCCTGCTTATGTTTCCTGTGGGG - Intergenic
1116855282 14:49946542-49946564 TCCTTCCCCTGTTTCATATGTGG + Intergenic
1117736369 14:58772999-58773021 TGATGCCCATGTTACAGGTGGGG - Intergenic
1119555795 14:75551418-75551440 TCCAGCCGATGTTACAGTTGTGG + Intergenic
1119888357 14:78163605-78163627 TTCTCCCCATCTGACATGTGAGG - Intergenic
1121000776 14:90450835-90450857 TCCTCCCCATGTTATAGATGAGG - Intergenic
1121001038 14:90452308-90452330 TCCTCCCCATTTTACAGATGAGG - Intergenic
1121003466 14:90470011-90470033 TCCTCCCCAGGTTACAAGTTTGG - Intergenic
1121422854 14:93827724-93827746 TCCTCCCCATTTTACAGATGAGG + Intergenic
1121465163 14:94111175-94111197 TCCTCCGCATGTTACAGATGAGG - Intronic
1122229620 14:100299235-100299257 TCCTGCCCATGTCAGGTGTTTGG - Intronic
1124336857 15:28863869-28863891 TCCTGCCCTTCTTATGTGTGAGG - Intergenic
1125736904 15:41933290-41933312 TCCTCCCCAGGATACACGTGTGG - Intronic
1127635289 15:60863608-60863630 TTATGCCTATTTTACATGTGAGG - Intronic
1127921176 15:63495391-63495413 TCCTCCCCATTTTACATATGAGG - Intergenic
1128385485 15:67145207-67145229 GCCTGCCCATTTTATAGGTGAGG + Intronic
1129513123 15:76139481-76139503 TCGTGCACATGTGACCTGTGCGG + Intronic
1129754772 15:78091397-78091419 TCATGCCCATTTTACAGATGAGG + Intronic
1130430318 15:83841269-83841291 TCCTGCCTATTTTACAGATGAGG + Intronic
1131467727 15:92668853-92668875 TTATGCCCATATTACAGGTGAGG - Intronic
1131836089 15:96392615-96392637 TTCTGCCCATTTTACAGGTGAGG + Intergenic
1133487475 16:6234038-6234060 GCCTGCCCATCTGCCATGTGAGG - Intronic
1133647798 16:7780716-7780738 TCCTGTCCATGTAACCTCTGTGG - Intergenic
1133707129 16:8365471-8365493 TCATGCCCATTTTAAATATGAGG + Intergenic
1133877193 16:9746145-9746167 GCCTGGCCATTTTACATATGAGG - Intergenic
1134039783 16:11059801-11059823 TCATGCCCATTTTACAGATGAGG + Intronic
1134085991 16:11357840-11357862 TCTTGCCCATATTACATCTCAGG - Intergenic
1134308507 16:13055195-13055217 TTATGCCCATTTTACAGGTGGGG + Intronic
1135673731 16:24396435-24396457 TCCTGAACATAGTACATGTGTGG - Intergenic
1136072007 16:27792874-27792896 TTCTGCCCATTTTACAGATGAGG + Intronic
1138124117 16:54424691-54424713 TCATGCCCATTTTACAGATGAGG - Intergenic
1138447592 16:57074249-57074271 TCGTCCCCATTTTACAGGTGAGG - Intronic
1141306314 16:82867127-82867149 ATCTGCCCATTTTACAGGTGAGG + Intronic
1141394588 16:83693227-83693249 TCCTCCCCATGTTTCAGGTGGGG - Intronic
1141467343 16:84215001-84215023 TCCTGCCCGTTTTACAGGTGTGG - Intergenic
1141748231 16:85940538-85940560 TCATTCCCATGTTACAGATGAGG + Intergenic
1141802293 16:86318254-86318276 TTCTGCCCATTTTACAAGTGAGG - Intergenic
1142139572 16:88466844-88466866 TCATGCCCATGATACAAGTGAGG - Intronic
1142599522 17:1046815-1046837 TCCTCCCCATCTTACAGATGAGG - Intronic
1143337026 17:6179038-6179060 CCCTGCCCATCTTATCTGTGAGG - Intergenic
1143898223 17:10153707-10153729 TCATGCCCATTTTACAGATGAGG + Intronic
1144146543 17:12404572-12404594 ACCTCCCCAGGTTACAGGTGAGG - Intergenic
1146473891 17:33146327-33146349 ACCTGTCCATGTTACAGATGAGG + Intronic
1146835217 17:36105123-36105145 GCCTGACCATGGTCCATGTGGGG - Intronic
1146849831 17:36212369-36212391 GCCTGACCATGGTCCATGTGGGG - Exonic
1147567821 17:41548408-41548430 TACTGCCCATTTTACAGATGAGG + Intergenic
1147601900 17:41751872-41751894 TCATCCTCATTTTACATGTGAGG + Intergenic
1148840397 17:50492366-50492388 TCATGCCCATTTTACAAATGAGG + Intergenic
1150608910 17:66717500-66717522 GGCTGCCCATGTTACAGATGAGG - Intronic
1155160882 18:23194640-23194662 TCCTGCTCATCTTAAAAGTGTGG - Intronic
1156389041 18:36633544-36633566 TCGTCCCCATTTTACAGGTGAGG + Intronic
1157231346 18:45919492-45919514 TTCTAGGCATGTTACATGTGTGG + Intronic
1159513052 18:69421440-69421462 TCATGCCCATTTTACAGATGAGG - Intronic
1159787610 18:72732938-72732960 GCTTGGCCATGTTACATGTGTGG + Intergenic
1161616908 19:5276019-5276041 CCATCCCCATTTTACATGTGAGG + Intronic
1162423236 19:10578196-10578218 TCCTGTCCATTTTACAGATGAGG - Intronic
1162683522 19:12364081-12364103 TCCTGAACATTTCACATGTGAGG - Intronic
1162948984 19:14059403-14059425 TCCTGCCCATCTTACAGATGAGG - Intergenic
1163562783 19:18030289-18030311 TCATGCCCATTTTACAGATGAGG - Intergenic
1163629840 19:18412688-18412710 TTCTCCCCATGTTACAGATGGGG - Intergenic
1163630165 19:18414314-18414336 TTCTCCCCATGTTACAGATGGGG - Intergenic
1164544511 19:29148589-29148611 TCCTTTTCCTGTTACATGTGAGG - Intergenic
1164794281 19:31013945-31013967 TCCTGCCCAGATTTAATGTGTGG - Intergenic
1165299443 19:34959442-34959464 ACCTGCCCCTGTGACATATGTGG - Exonic
1167197891 19:48043372-48043394 TCATTCCCATTTTACAGGTGAGG - Intronic
1167221694 19:48203444-48203466 TCCAGCCTATGTTACAGTTGAGG + Intronic
1168147141 19:54426158-54426180 TGCTCCCCACGTTACATGTAGGG + Intronic
924966327 2:79890-79912 ACAGGCCCATGTTACATGTTAGG - Intergenic
925531105 2:4863508-4863530 TCATGCCCATTTTAAAAGTGAGG - Intergenic
927196899 2:20554241-20554263 TTCTGCACATCTTACAAGTGAGG - Intergenic
927337972 2:21947427-21947449 TGCTCCACATGTCACATGTGAGG - Intergenic
927469454 2:23361894-23361916 TCCTAACCATTTTACATGTACGG - Intergenic
927646472 2:24880215-24880237 TCCAGCCCATCTGACATGTTAGG + Intronic
927860191 2:26555922-26555944 TCATGCCCATTTTACAGATGAGG + Intronic
927881040 2:26690287-26690309 ACCTTCTCATGTTACATATGAGG - Intergenic
928468794 2:31552433-31552455 TACTGTCAATGTTCCATGTGGGG - Intronic
928627603 2:33156496-33156518 TCCTTCCCATTCTACAGGTGAGG - Intronic
929937030 2:46300348-46300370 TTCTGCCCATATTGCATTTGGGG - Intronic
930690257 2:54355453-54355475 TCCTGCCCCTGCTACCTGTTTGG + Intronic
931234036 2:60398495-60398517 TCCTGCCCAAGTTACATTATGGG + Intergenic
933990233 2:87628590-87628612 TTATGACTATGTTACATGTGTGG - Intergenic
934021318 2:87956675-87956697 TCCTGCCCATGCTTCCTGGGAGG - Intergenic
934687368 2:96331547-96331569 TCCCCTCCATTTTACATGTGAGG + Intergenic
936303613 2:111322234-111322256 TTATGACTATGTTACATGTGTGG + Intergenic
937860732 2:126707031-126707053 TTCTCCCCATGTTACAGATGAGG + Intergenic
938100453 2:128494472-128494494 TCATCCCCATTTTACATGTGAGG - Intergenic
938228904 2:129640876-129640898 TACTTCCCATTTTACATGTAAGG + Intergenic
938740433 2:134226587-134226609 TGCTTCCCATTTTACATGTGTGG - Intronic
939956962 2:148535246-148535268 TCATTCCCATGTTACAGATGAGG - Intergenic
941871341 2:170389133-170389155 TTATGCCCATGTTGCATATGAGG - Intronic
942306856 2:174617083-174617105 TAGGGCCCATGTTACATGTGGGG + Intronic
944134905 2:196388485-196388507 TCATTCCCATGTTACCTGTGGGG + Intronic
946882991 2:224194840-224194862 TCCTGCACTTGTGATATGTGGGG + Intergenic
1169014473 20:2280369-2280391 CCCAGACCATGTTACAAGTGGGG - Intergenic
1169264656 20:4160508-4160530 TGCTGCCCATTTTACAGATGAGG - Intronic
1170153524 20:13249372-13249394 GCCTGCCCGTGTTTCATGTCTGG - Intronic
1172215645 20:33233812-33233834 TGCTCCCCATTTTACAGGTGAGG + Intergenic
1173035725 20:39407935-39407957 TTCTGCCTTTGTTACTTGTGTGG + Intergenic
1174550158 20:51356356-51356378 TCATCCCCATTTTACAGGTGGGG - Intergenic
1175192923 20:57223632-57223654 TCATCCCCATTTTACAGGTGCGG - Intronic
1175955007 20:62604698-62604720 GCCCACCCATGTCACATGTGGGG - Intergenic
1176277649 20:64281919-64281941 TTCTGCCCATTTTGCATGGGAGG + Intronic
1178590484 21:33905359-33905381 TTATGCCCATTTTACATATGAGG + Intronic
1179080600 21:38167184-38167206 TCATCCCCATTTTACATATGAGG + Intronic
1179310303 21:40189586-40189608 TCATTCCCATGTTTCATGGGAGG + Intronic
1179560860 21:42215278-42215300 TCCTGCCCTTGGTGCTTGTGAGG - Intronic
1182021749 22:27087238-27087260 TCATGCCCATTTTACAGATGAGG + Intergenic
1182079715 22:27520363-27520385 ACCTGCCCATTTTACAGATGAGG + Intergenic
1182093040 22:27609053-27609075 TCATCCCCATTTTACAGGTGAGG + Intergenic
1183472685 22:38017907-38017929 TCATGCCCATTTTACAAGTGAGG - Intronic
1183545260 22:38452054-38452076 TCATCCCCATTTTACAGGTGGGG + Intronic
1183834025 22:40437180-40437202 ACCTGCCCATGTAAGAAGTGGGG - Intronic
1184495920 22:44841388-44841410 TCCCGCCCATGTGACAGGAGAGG + Intronic
1185231572 22:49686938-49686960 TCCTGCCCATGGAGCAGGTGGGG + Intergenic
950332649 3:12168752-12168774 ACCTGCTCATTTTACAGGTGAGG + Intronic
951465236 3:22993427-22993449 GCCTGGCCAAGTTACAAGTGCGG - Intergenic
951744939 3:25967540-25967562 TTATGCCCATTTTCCATGTGAGG + Intergenic
952523665 3:34187116-34187138 TCTTGTCCATTTTACAGGTGAGG + Intergenic
955616358 3:60811661-60811683 TCATTTCCATGTTATATGTGAGG - Intronic
955700464 3:61677378-61677400 TTCTTCCCACTTTACATGTGAGG + Intronic
956727024 3:72164490-72164512 TTATGCCCATTTTACAGGTGAGG - Intergenic
956765840 3:72483760-72483782 TCATGCCCATTTTACAGGTGAGG + Intergenic
957064783 3:75512788-75512810 TCTTGGTCATGTTACATGTCTGG + Intergenic
957603205 3:82365632-82365654 GCCTGCTACTGTTACATGTGTGG + Intergenic
958470719 3:94514528-94514550 TCCTGAGCATTTTATATGTGTGG + Intergenic
960996402 3:123343373-123343395 CCCACCCCATGTTACAGGTGAGG + Intronic
961444202 3:126971483-126971505 TCCTGCCCATGGTTTATGTCCGG + Intergenic
961877387 3:130033824-130033846 TCCTCCTAATGTCACATGTGGGG + Intergenic
962189814 3:133298680-133298702 TTATGCCCATGTTACAGGTGAGG + Intronic
963400952 3:144798306-144798328 TCCCTCCCATGACACATGTGGGG + Intergenic
964698497 3:159536912-159536934 TTATGCCTATGGTACATGTGTGG + Intronic
967586424 3:191219706-191219728 TCCTGTCTATGGTACTTGTGTGG - Intronic
968133046 3:196203368-196203390 TGCTGCCCATTTTACAGTTGGGG + Intronic
968137812 3:196231681-196231703 GCCTGCCCATGGTTAATGTGGGG + Intronic
969241386 4:5900754-5900776 TCCTCCCCATTTTACAGGCGAGG - Intronic
969363784 4:6682079-6682101 TCATGCCCATCTTACGGGTGGGG - Intergenic
971528430 4:27652922-27652944 TCTTGACCATGTGACTTGTGGGG - Intergenic
972771707 4:42203434-42203456 TCCTGCCCATCTTGAAAGTGGGG - Intergenic
973536945 4:51893078-51893100 TCCTGAACATGTTACAAATGAGG + Intronic
973809501 4:54556471-54556493 TGCTGCCCATGCTTCATGAGAGG + Intergenic
977488559 4:97680667-97680689 TCATGCCCATTTTAAAGGTGAGG + Intronic
978371675 4:108035768-108035790 TCCTACCCAGGTTCTATGTGCGG - Intergenic
979707562 4:123738684-123738706 TTTTCCCCATGTTACAAGTGAGG - Intergenic
984424310 4:179563764-179563786 TCCTGCCCATGTTCCTTGAGTGG - Intergenic
984772285 4:183446340-183446362 TCCTGCCGTTGTTACCTGAGAGG - Exonic
985169414 4:187132579-187132601 TCTTGCCCATGGTACATATTTGG - Intergenic
985317166 4:188670463-188670485 TCCTGACCATATCACATCTGGGG + Intergenic
987718244 5:21599297-21599319 TCCTACTCATTTTACATATGAGG + Intergenic
989164207 5:38418753-38418775 TCATGCCCATTTTACAGATGAGG + Intronic
991318113 5:65335219-65335241 TCCTGCTCATTTTACATTTGAGG + Intronic
991398277 5:66227102-66227124 TCCTTCCTTTGTTACATGGGTGG + Intergenic
993212496 5:84970736-84970758 TCCTTCCCTTTTTTCATGTGAGG + Intergenic
993847770 5:92966940-92966962 TCCTGCCCCTCATTCATGTGAGG - Intergenic
993860261 5:93127479-93127501 TCATGCCCAGTTTACATGGGTGG + Intergenic
994320726 5:98392045-98392067 TCCTGCCCAAGTGACAGGTGCGG - Intergenic
994659785 5:102640119-102640141 TCATGCCCATTTTGCAGGTGAGG + Intergenic
997387745 5:133486946-133486968 TCCTGCCAGTGTCACATGTCAGG - Intronic
997813989 5:136998759-136998781 TGCTGCCTGTGTCACATGTGTGG + Intronic
997942151 5:138167983-138168005 TCCTTCCCATGATACATGGTGGG - Exonic
998793902 5:145796854-145796876 TCGTTCCCATTTTACATGTGAGG - Intronic
999291120 5:150427189-150427211 GCATGCCCATTTTACAGGTGAGG - Intergenic
999319542 5:150604997-150605019 TCCTGCCCACTTTACAGATGAGG - Intronic
999321926 5:150620748-150620770 TTCTCCCCATTTTACAGGTGAGG + Intronic
999692326 5:154158922-154158944 TTATACCCATGTTACATATGGGG + Intronic
1001213194 5:169830193-169830215 TTCTTCCCATGTTACAAATGAGG - Intronic
1001235323 5:170024429-170024451 TCATCCCCATGTTACAAATGAGG - Intronic
1001598459 5:172913736-172913758 GCCTGCCCATTTTACAGATGGGG + Intronic
1002090117 5:176799334-176799356 TCCTGCTCATTTTACAGATGAGG - Intergenic
1002592469 5:180300153-180300175 TCCAGCCCATGATACAGGTGAGG + Intergenic
1003459490 6:6317262-6317284 TCATCCCCATGTTATATGTTAGG - Intronic
1003569580 6:7247214-7247236 GCCTGCCCTGGTTACCTGTGTGG - Exonic
1004262295 6:14118489-14118511 TGATGCCCATGATACATGGGAGG + Intronic
1004880373 6:20001679-20001701 TCCTCCCCATGTTATAGGTAAGG + Intergenic
1006429958 6:33989275-33989297 TCCTTCCCACTTTACAGGTGAGG + Intergenic
1006905759 6:37532335-37532357 TTGTGCCCATGTTACAGATGTGG - Intergenic
1006929843 6:37681003-37681025 TCCTGCCCAGGTTTCCTGGGGGG - Intronic
1008014103 6:46498747-46498769 TCTTTTCCATGTTATATGTGAGG + Intergenic
1009195864 6:60683662-60683684 TCGTGCCCATTTTAAATATGAGG - Intergenic
1010929890 6:81789017-81789039 TTCTGCCAATGTTACATGGGTGG + Intergenic
1011993716 6:93557767-93557789 TTCTACCCATGTTCCAGGTGAGG - Intergenic
1012085473 6:94820458-94820480 GCCTGCCCTTCTTTCATGTGTGG + Intergenic
1014100751 6:117509130-117509152 GCCTGCCCATTTTAAATATGAGG - Intronic
1015232166 6:130927658-130927680 TCCTCCTCAAGATACATGTGTGG - Intronic
1015295977 6:131593073-131593095 TGCTCTCCATGTTACTTGTGTGG - Exonic
1018068947 6:160144121-160144143 TCATCCCCATATTACATATGAGG + Intronic
1018371369 6:163171451-163171473 TTCTGCCCATTTTACAGATGAGG + Intronic
1018525926 6:164710044-164710066 TCCTGCCTTTGTAATATGTGTGG + Intergenic
1019567458 7:1691515-1691537 CCCTGCCCATTTTACAGATGAGG - Intronic
1022298391 7:29079466-29079488 TTCTTCCCATTTTACAGGTGAGG - Intronic
1022652908 7:32293577-32293599 TACTCCCCATTTTACATGTGAGG + Intronic
1023186092 7:37534678-37534700 TCGTGCCCATGTTACAGATGAGG + Intergenic
1023467760 7:40476109-40476131 TCATCCCCATTTTACATATGAGG - Intronic
1023904761 7:44514096-44514118 TCCTTCCCATTTTACAGATGAGG - Intronic
1024654248 7:51435613-51435635 TCCTTCCCAGTTTACAGGTGAGG - Intergenic
1024827306 7:53406301-53406323 ACCTGCCCATGTTCCATTTTTGG + Intergenic
1026191357 7:68131060-68131082 TCATCCCCATTTTACATTTGAGG - Intergenic
1028614931 7:92755474-92755496 CCCTCGCCATGTTTCATGTGAGG - Intronic
1029487378 7:100851999-100852021 TTATGCCCATTTTACATATGAGG + Intronic
1031976253 7:128095465-128095487 TCCTTCCCATGTAACATGCTTGG + Intergenic
1035284842 7:157799523-157799545 TCCTGCCCCAGCTCCATGTGCGG + Intronic
1035810446 8:2486643-2486665 TCCTCCCCATTTTACAGATGAGG + Intergenic
1036961282 8:13247511-13247533 TCCTTTCCATTTTACAGGTGAGG + Intronic
1037251282 8:16897492-16897514 TCATGTCCATGTTTCATCTGGGG + Intergenic
1038449619 8:27631654-27631676 TGCTGCCCATTTTACAGATGAGG - Intergenic
1041215277 8:55594403-55594425 TCATGCCCATGTTAGAGATGGGG - Intergenic
1042959996 8:74293443-74293465 TCATGCCCATTTTACAGATGGGG + Intronic
1043367710 8:79554616-79554638 TTCTGTCCATGTTCCATGTCAGG + Intergenic
1043381031 8:79702272-79702294 TCTAAGCCATGTTACATGTGTGG - Intergenic
1047338166 8:123955611-123955633 TCCTGCCCACCTTACAGATGAGG - Intronic
1048051268 8:130819102-130819124 TCATACCCATTTTACAGGTGAGG + Intronic
1048537540 8:135311545-135311567 TACTGCCCAGGTTCCATGGGAGG + Intergenic
1048753457 8:137705334-137705356 TGCTCCCAATGTTAAATGTGGGG - Intergenic
1049116373 8:140691719-140691741 TTCTGCCTATTTTACAGGTGAGG - Intronic
1049541275 8:143210287-143210309 TCCTGCCTAGGTGACATGTGGGG - Intergenic
1049921314 9:367063-367085 TCATCCCCATGTCACAAGTGAGG - Intronic
1050020041 9:1273830-1273852 TCCAGACCAGGTTACATGAGAGG - Intergenic
1052741159 9:32394322-32394344 TGCAGCCCATGCTACAGGTGTGG - Intronic
1053044246 9:34900831-34900853 TTCTGCCCTTCTTCCATGTGAGG + Intergenic
1055790261 9:79915883-79915905 TTATCCCCATTTTACATGTGAGG + Intergenic
1056537448 9:87542349-87542371 TCATGCCCATTTTACAGATGAGG + Intronic
1059825244 9:118020816-118020838 TCATGCCCATTTTACAGATGAGG - Intergenic
1060758963 9:126232969-126232991 TTATCCCCATGTTACAGGTGAGG + Intergenic
1061315667 9:129794346-129794368 TCCTGCCCACCTCACATGTTTGG - Intergenic
1061750487 9:132773613-132773635 TCATTGCCATGTTACATGGGAGG + Intronic
1062019922 9:134314475-134314497 TGGTGCCCATTTTACAGGTGAGG + Intergenic
1062196889 9:135279384-135279406 TCATGCCCACTTTACAGGTGAGG + Intergenic
1186272935 X:7909196-7909218 TACTTCCAATTTTACATGTGAGG - Intronic
1190257233 X:48772772-48772794 TCCTTCCCATTTTACAGATGAGG + Intronic
1193773079 X:85610737-85610759 TCCTGCCCAGGTTACATTGTGGG + Intergenic
1197411777 X:126124522-126124544 TCCTGCCCAAGTTGCTTGTCTGG - Intergenic
1198079787 X:133228370-133228392 GCCTGCCCATAATATATGTGGGG - Intergenic
1198614496 X:138441393-138441415 TCATTCCCATTTTACATATGAGG + Intergenic
1199123208 X:144082446-144082468 TCCTGCCCATGCTTCCTGGGAGG + Intergenic
1199338399 X:146646368-146646390 TCCTACCCACGTTAAATGTGTGG + Intergenic
1200254305 X:154571537-154571559 TTCTGCCCTTGTTACAGATGAGG - Intergenic
1200263464 X:154632871-154632893 TTCTGCCCTTGTTACAGATGAGG + Intergenic