ID: 1083252622

View in Genome Browser
Species Human (GRCh38)
Location 11:61478039-61478061
Sequence TTTTCCTTTTAGCAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 427}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083252622_1083252629 -1 Left 1083252622 11:61478039-61478061 CCCTCCACCTGCTAAAAGGAAAA 0: 1
1: 0
2: 4
3: 38
4: 427
Right 1083252629 11:61478061-61478083 ACCTGGCTACAGCCTACCTGGGG 0: 1
1: 0
2: 1
3: 6
4: 128
1083252622_1083252627 -3 Left 1083252622 11:61478039-61478061 CCCTCCACCTGCTAAAAGGAAAA 0: 1
1: 0
2: 4
3: 38
4: 427
Right 1083252627 11:61478059-61478081 AAACCTGGCTACAGCCTACCTGG 0: 1
1: 0
2: 0
3: 10
4: 109
1083252622_1083252628 -2 Left 1083252622 11:61478039-61478061 CCCTCCACCTGCTAAAAGGAAAA 0: 1
1: 0
2: 4
3: 38
4: 427
Right 1083252628 11:61478060-61478082 AACCTGGCTACAGCCTACCTGGG 0: 1
1: 0
2: 0
3: 13
4: 129
1083252622_1083252631 0 Left 1083252622 11:61478039-61478061 CCCTCCACCTGCTAAAAGGAAAA 0: 1
1: 0
2: 4
3: 38
4: 427
Right 1083252631 11:61478062-61478084 CCTGGCTACAGCCTACCTGGGGG 0: 1
1: 0
2: 0
3: 18
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083252622 Original CRISPR TTTTCCTTTTAGCAGGTGGA GGG (reversed) Intronic
900510766 1:3059813-3059835 TTTTCATTTTAGAGGATGGAAGG - Intergenic
901470553 1:9453204-9453226 TTTTTCTTTTAACAGGTGTTTGG + Intergenic
902252939 1:15167428-15167450 ATATCCTTTTAACAGGTGAAGGG - Intronic
902265113 1:15257683-15257705 CTTTCCCTTCAGCACGTGGAGGG + Intronic
902889077 1:19428408-19428430 TTTTTTTTTTGGCAGGTGGGGGG - Intronic
903400954 1:23047894-23047916 TTTTTTTTTTGGCAGGGGGAAGG - Intronic
905504621 1:38467368-38467390 CTTGCCTTTTAGCAGGTGGGAGG - Intergenic
906006394 1:42476164-42476186 TTTTCCTTCTAGCAAAGGGAGGG + Intronic
906016332 1:42584113-42584135 TTTTGTTTTTTCCAGGTGGAAGG - Intronic
906067473 1:42992387-42992409 TTGTGCTTTCAGCAGGGGGATGG - Intergenic
906253699 1:44331308-44331330 TTTTTTTTTAAGCAGGGGGAAGG + Intronic
906908869 1:49925132-49925154 TTTTCCTTTTCTCAAGTGAAAGG - Intronic
906938275 1:50233799-50233821 TATGCCTTTTAGCAGGGGAAGGG - Intergenic
907767236 1:57423716-57423738 TTTTCCTCCCAGCAAGTGGAGGG + Intronic
907973407 1:59407211-59407233 TTGTCCTTTTAGCTGATGGGTGG + Intronic
907993513 1:59606330-59606352 TTTTACTTTTGACAAGTGGAAGG - Intronic
908193609 1:61727718-61727740 TTTTCCTTTTTGGAGGGAGAGGG - Intergenic
908807972 1:67950231-67950253 TTTGCTTTTAAGCAAGTGGAGGG + Intergenic
908853729 1:68399438-68399460 ATTTCCTTTTAGTATGTAGACGG + Intergenic
909093770 1:71260836-71260858 TCGTCTTTTTAGCTGGTGGAGGG + Intergenic
910300208 1:85697327-85697349 TTTTCCTTTTGGCTTCTGGATGG + Intronic
910740920 1:90515280-90515302 TTTTCCTCTTAGGAGCTGTATGG - Intergenic
910920836 1:92344761-92344783 CTTTCATTTTTCCAGGTGGATGG + Intronic
911333461 1:96552556-96552578 TTTTCTTTTAAGCATGTGTATGG + Intergenic
912718319 1:111998672-111998694 TTTTCCATTCAGCCAGTGGATGG - Intergenic
912724504 1:112046648-112046670 TTTTGGTTTAAGCAGATGGAAGG - Intergenic
913111193 1:115658722-115658744 GTTTCCTGTTGGCAGCTGGAGGG + Intronic
916778964 1:168002170-168002192 TCTTCCTTTTGTCAGCTGGAAGG + Intronic
916850479 1:168698111-168698133 TTTTCAGTTTAGAAGCTGGATGG - Intronic
917695898 1:177523728-177523750 TTCTCCCTTTAGTTGGTGGATGG + Intergenic
919034911 1:192294117-192294139 TTTTTTTTTTGGCAGGGGGAGGG + Intergenic
919101923 1:193105976-193105998 TTTTTTTTTTGGCAGGTGGTGGG - Exonic
919812649 1:201418957-201418979 TTTGCCTATCAGAAGGTGGAGGG + Intronic
920405350 1:205705090-205705112 TTTTCTTTTTAGAAAGAGGAAGG + Intergenic
921071452 1:211661623-211661645 TTTTCATTTTGGCTAGTGGACGG - Intronic
921660863 1:217800762-217800784 AATTAATTTTAGCAGGTGGAAGG - Intronic
1064079323 10:12295632-12295654 TTTTCCTTTTTGCAGGGACAGGG + Intergenic
1064532532 10:16324824-16324846 TTTTCTTTTCAGCACTTGGATGG + Intergenic
1064538996 10:16387286-16387308 TTTTTTTTTTTGCAGGGGGAAGG + Intergenic
1064590419 10:16884394-16884416 TTTTTTTTTTAGCAGATTGAGGG + Intronic
1065807068 10:29403871-29403893 TTTTTATTTTACCAGGTGGGAGG - Intergenic
1068172109 10:53407074-53407096 TTTTTCTTTTAATGGGTGGATGG - Intergenic
1068554644 10:58445502-58445524 TTTTGTTTTTAACAGGTGTATGG - Intergenic
1068626186 10:59250631-59250653 TTTTCAGTTCAGCAGGTTGAGGG - Intronic
1069214383 10:65801251-65801273 TTTTTCCCTTAGTAGGTGGAAGG + Intergenic
1069854254 10:71430882-71430904 TGTTCTTTTTAGCAGCTGCAGGG - Intronic
1070533245 10:77355829-77355851 TTCTCCTTTTACCAGAAGGATGG - Intronic
1072024686 10:91443320-91443342 TTTTCCTTCTAACAGTTAGAAGG + Intronic
1072025011 10:91446275-91446297 TTTTCCTTCTAACAGTTAGAAGG - Intronic
1072094614 10:92165412-92165434 TTTTTTTTTTGGCTGGTGGAAGG + Intronic
1073369233 10:102971672-102971694 TCTTCATTTTAGCAGCTGCATGG + Intronic
1074167010 10:110889518-110889540 TTTTCCTTTTTACAGTTGGTGGG + Exonic
1074468863 10:113708616-113708638 TTTTCCTTGTTGCATTTGGAGGG + Intronic
1074503854 10:114049845-114049867 TTTACCCTTTTGTAGGTGGAGGG + Intergenic
1074650016 10:115510469-115510491 GTTTTCTTTTTGCTGGTGGAGGG - Intronic
1075424678 10:122332424-122332446 TTTTCCTTTCAGCTGGAGAATGG + Exonic
1075533623 10:123252138-123252160 TTATCTTTTTAAAAGGTGGAGGG - Intergenic
1077099633 11:816342-816364 TTTCCCTTGGAGCAGGTTGAGGG + Intergenic
1078671488 11:13369743-13369765 TTTTTCTTTGAGCAGGTAGAGGG - Exonic
1078959888 11:16252766-16252788 TTTTCCTTCTCCCAAGTGGAAGG - Intronic
1082264766 11:50106769-50106791 TTTTCCTTTTTGTATGGGGAAGG - Intergenic
1083252622 11:61478039-61478061 TTTTCCTTTTAGCAGGTGGAGGG - Intronic
1083519838 11:63298905-63298927 TTTTTCTTGTATCAGGTGGCTGG + Exonic
1083584578 11:63847448-63847470 TTTTCTTTTTAACATGAGGAAGG + Intronic
1084156040 11:67313039-67313061 TTTGCTTTGTAGCAGGAGGAAGG - Intergenic
1084230842 11:67751486-67751508 TTTTCCTTTTAGGAAGTGAGAGG + Intergenic
1085014376 11:73163264-73163286 TTTTACCTTAAGCTGGTGGAGGG + Intergenic
1086333148 11:85773963-85773985 TTTTTCTTTTACCAAGAGGAAGG + Intronic
1087947978 11:104187876-104187898 TTGTCTTTTTAACAGGTGAATGG + Intergenic
1088086518 11:105987262-105987284 TTTTCCTTCCAGGAGATGGAAGG + Intergenic
1088970084 11:114766282-114766304 TTTGATTTATAGCAGGTGGAAGG - Intergenic
1089234449 11:117011141-117011163 ATTTCCTTTTTTCAGGAGGAGGG - Intronic
1090449283 11:126791790-126791812 GACACCTTTTAGCAGGTGGAGGG + Intronic
1090659956 11:128874906-128874928 TGTTCCATTTAGGAGCTGGAGGG - Intergenic
1090661648 11:128886511-128886533 ATTCTCTTTGAGCAGGTGGAGGG + Intergenic
1090689692 11:129166597-129166619 TTTTCCTTTTAGCACACTGAAGG - Intronic
1092368988 12:7900871-7900893 TTATCCTTTCGGCAGGTGGAGGG - Intergenic
1094023522 12:25939499-25939521 CTTTTCTTTTACCAGGTAGAAGG - Intergenic
1094505771 12:31059897-31059919 TTTTGCTTTTAGTTGGTGAAAGG + Intergenic
1095813986 12:46401341-46401363 GTTGCCTTTTACCAGATGGAGGG + Intergenic
1096128936 12:49141885-49141907 TTTTATTTTTAGCAGATGCAGGG + Intergenic
1096302242 12:50440427-50440449 TTTTCTTTTTAGGAAGTGAAAGG + Exonic
1097614306 12:61865102-61865124 CTTTCCTTTCAGGAGGGGGAGGG - Intronic
1098357123 12:69622396-69622418 TTTTCCTATTTGCATGTGGAGGG + Intergenic
1098838691 12:75452922-75452944 TTTTGCTTCTGGCAGGGGGAAGG - Intergenic
1099139668 12:78956472-78956494 TTTTCTTTCTAGCAGGGGTAGGG - Intronic
1099708445 12:86187739-86187761 TTTTTTTTTTTGCAGTTGGAAGG - Intronic
1102016305 12:109650169-109650191 GCTTCCTTTTAGCTGTTGGATGG - Intergenic
1102808887 12:115806793-115806815 TTTTCCTTTGGGGAGGGGGAAGG - Intergenic
1103493507 12:121342496-121342518 TTTTATTACTAGCAGGTGGAAGG - Intronic
1106144479 13:27039406-27039428 CTTGCCTCTCAGCAGGTGGAGGG - Intergenic
1106288132 13:28336019-28336041 TTTTCTTTTTAGATGGTGGAAGG - Intronic
1106445067 13:29822204-29822226 ATTTACTTTTAGCTGGTGAAAGG + Intronic
1109645113 13:65244098-65244120 GTTTGCTTCTAGCAGGAGGATGG - Intergenic
1110918569 13:81055611-81055633 TTTTCTTTTTGCCATGTGGATGG - Intergenic
1111843772 13:93483150-93483172 TTTTCATTTTAGCAAGGGCATGG + Intronic
1112834422 13:103496781-103496803 TTTTTTTTTTAGCAGGGTGAGGG + Intergenic
1113917233 13:113881745-113881767 GTTTCATTTTGGAAGGTGGAGGG - Intergenic
1115272510 14:31569567-31569589 CTTTCCTTTGAGGATGTGGATGG + Intronic
1116132468 14:40874093-40874115 TTTTACTTTTAACAGAAGGAAGG + Intergenic
1116989986 14:51265465-51265487 GTTTCCTTTGAGGAGGAGGAAGG + Intergenic
1117221872 14:53614218-53614240 TTTTCCTTTCATCTGGTGGCAGG + Intergenic
1118072247 14:62257877-62257899 TTTTTGTATGAGCAGGTGGATGG + Intergenic
1118251823 14:64169174-64169196 TTTTCCGTATGGTAGGTGGATGG + Intronic
1118685597 14:68287427-68287449 TGTTCCTTCTAATAGGTGGATGG + Intronic
1119013044 14:71016798-71016820 TTGTTCTTCTAGCAAGTGGAAGG - Intronic
1119839562 14:77781915-77781937 TCCTCCTTTTAGCAAGTAGAAGG + Intergenic
1119963941 14:78892102-78892124 TTTCTCATTTAGCAGGTGTATGG - Intronic
1119978120 14:79048633-79048655 TTTTATTTTTTGCTGGTGGAGGG + Intronic
1120783581 14:88509523-88509545 TTTGGCTGTTAGCAGGTGGAAGG - Intronic
1121229213 14:92344225-92344247 TTTTCCTTTTCCCATGAGGATGG + Intronic
1121575757 14:94985254-94985276 TTTTCCTGTTCTCAGGGGGAAGG - Intergenic
1122805991 14:104257342-104257364 TCTTGCTTATTGCAGGTGGAAGG - Intergenic
1124992949 15:34693657-34693679 TCTTCCTTTTGGCAGGGGCAGGG - Intergenic
1125106651 15:35979494-35979516 TTTTCCATTTTGAAGGTAGATGG + Intergenic
1126452556 15:48825177-48825199 TTGTCTTTTTAGCAGGAAGAGGG + Exonic
1126781789 15:52145249-52145271 TTATCCTTTTAGGAAGTAGATGG + Intronic
1128538056 15:68505329-68505351 TTCTGCTCTGAGCAGGTGGAGGG + Intergenic
1129937678 15:79464232-79464254 ATGTCCATTTAACAGGTGGAGGG - Intronic
1130393247 15:83478214-83478236 ATTTCCTCTGAGCAGGTAGAAGG + Intronic
1131760145 15:95613586-95613608 TTTTTCTTGTAACATGTGGAAGG - Intergenic
1135740398 16:24970302-24970324 TCTTCCTTTTAGTAGGTGTCAGG - Intronic
1140643337 16:77002656-77002678 TCTGCCTCTCAGCAGGTGGATGG - Intergenic
1140712937 16:77695117-77695139 TTTTCTTTTTAGGGGGTGGGTGG + Intergenic
1140880239 16:79191534-79191556 TTTTGCTTCTAGCTGGTCGAAGG + Intronic
1141288350 16:82693680-82693702 TTTACCTTTTAACATGTGGCAGG - Intronic
1142479271 17:208198-208220 CTTTCCTGGTAGAAGGTGGAAGG - Intergenic
1143080845 17:4380338-4380360 TTTTATTTTTAGTAGGTGGGGGG + Intergenic
1143412217 17:6716489-6716511 TTTTTTTTTTTGCAGGGGGACGG - Intergenic
1144710680 17:17399584-17399606 TTTTCCTTCTAGCAGTCAGAGGG + Intergenic
1145737559 17:27243696-27243718 TTTTACTTATGGCAGGTGGGTGG - Intergenic
1147017770 17:37506275-37506297 TTTTCTTTTTTGCAGGGGGACGG - Intronic
1149109956 17:53017102-53017124 TTTTCTTTTTAGCAGGAGTGAGG - Intergenic
1149250139 17:54758982-54759004 TTTCCCTGTTAGCAAGTGAAAGG - Intergenic
1151680193 17:75619060-75619082 TTTTCCTTCATGCATGTGGATGG + Intergenic
1151862642 17:76776822-76776844 TTTTCTTTTTAGCAGAGGCAGGG + Intronic
1151885428 17:76920732-76920754 ATGTCCTTTGAGCACGTGGAAGG + Intronic
1154952543 18:21224402-21224424 TTTTTTTTTTTGCTGGTGGAGGG + Intergenic
1155004958 18:21720495-21720517 TTTTTTTTTTAGAAAGTGGAAGG + Intronic
1155640246 18:28005271-28005293 TTTTCCATTTTGCTGGTTGAAGG + Intronic
1155729253 18:29131821-29131843 GTTTGATTTTAGCAAGTGGATGG + Intergenic
1156939105 18:42743304-42743326 TTTTGCCTTTAACAGTTGGATGG - Exonic
1158452760 18:57581528-57581550 TTTGCCTCTTAGGAGGAGGAGGG - Intronic
1158848034 18:61465241-61465263 TTTTCTTTTTAGCAGCTGTAGGG - Intronic
1158964328 18:62610192-62610214 TTGTCATTTTAGCAGGGAGATGG + Intergenic
1159204828 18:65236070-65236092 TTTTCCTATTTGAAAGTGGAAGG + Intergenic
1159244462 18:65787453-65787475 TTTACCTACTAGCAGGAGGATGG + Intronic
1160208274 18:76855554-76855576 CTTTCTTTTTAACAGGTGCATGG + Intronic
1160583964 18:79902712-79902734 TCTTCCCTTCCGCAGGTGGAGGG - Exonic
1161222945 19:3126395-3126417 TTTTCCTTTTAGGATGGGCAGGG - Intergenic
1161725798 19:5927872-5927894 TTTTCCTTTTAACAGGGGAGGGG - Intronic
1162056862 19:8069756-8069778 TTTTACTTTTTGTAGGTGGAGGG + Intronic
1164829623 19:31310501-31310523 ATCTCCTTTAAGAAGGTGGAAGG - Intronic
1166171528 19:41030719-41030741 TTTTCCTTTGAGAAGGGGGAAGG + Intergenic
926601979 2:14855012-14855034 TTTCTCCTCTAGCAGGTGGAAGG - Intergenic
927037750 2:19197919-19197941 TTTTCTTTTTAGCCTGTCGATGG - Intergenic
927274865 2:21254199-21254221 TCTTTCTTTGAGAAGGTGGAGGG + Intergenic
927366295 2:22300738-22300760 TTTTGATTTGAGAAGGTGGATGG + Intergenic
929478857 2:42282375-42282397 TTTTCCTTTTTTTTGGTGGAGGG + Intronic
930545145 2:52758194-52758216 TTTTACTTTGAGCAGGGGAAAGG - Intergenic
930981205 2:57528385-57528407 TTCTCCTTTCTGCAAGTGGAAGG + Intergenic
931316417 2:61136795-61136817 TTTTATTTTTAGTAGGTGCAGGG - Intronic
931402623 2:61944944-61944966 TTTTCCTTTTTGCTGCTGCAAGG + Intronic
931866283 2:66415070-66415092 CTTTCCTCTAAGTAGGTGGAAGG - Intergenic
932895327 2:75633906-75633928 TTTTCCTTTGGGCAAGTGAAAGG + Intergenic
933371702 2:81422966-81422988 TTTTTTTTTTGGCAGGGGGAAGG + Intergenic
934979125 2:98825847-98825869 TTTTCCTTTGGGCATATGGAAGG - Intronic
935590069 2:104838885-104838907 TTTTTTTTTTAGCAGCTAGAAGG + Intergenic
935789982 2:106582124-106582146 TTTTCCTTTTAGCCTGGGAATGG + Intergenic
937415055 2:121707894-121707916 TCTTCCTGTTAGCAGGTGTTTGG - Intergenic
939042768 2:137211048-137211070 TGTTCACTTTAACAGGTGGAGGG - Intronic
939256445 2:139750026-139750048 TTTTGCTTTTTGCGGGGGGAGGG + Intergenic
939512781 2:143127220-143127242 TTTTCTTTGTATAAGGTGGAAGG - Intronic
939516854 2:143179973-143179995 ATATCCTTTTTGCTGGTGGAAGG + Intronic
940035339 2:149306924-149306946 TTTCCTTTTTAGCTGATGGATGG + Intergenic
940393407 2:153159770-153159792 GTTTCCATTTAGCAGGTCAAGGG - Intergenic
940924527 2:159349273-159349295 GTTTTCTTTTTGCAGGTGAAAGG - Exonic
941118834 2:161505012-161505034 TTTGCTTTTTAGTAGGTGCATGG - Intronic
941351399 2:164441709-164441731 TTTCCCTTTTTGTATGTGGAAGG - Intergenic
942051464 2:172144836-172144858 TTTTTCTTTTCTCAGGTGGTGGG + Intergenic
943280946 2:185932404-185932426 ATTTCCTTTAAGCAGGTCGTAGG - Intergenic
945008947 2:205441352-205441374 TTTTACTTTTGGCAGGAGGTGGG - Intronic
945186773 2:207147538-207147560 TTTTCATTTTAACAGCTGAAAGG + Intronic
946341389 2:219071512-219071534 TTTTCATATTGGCAGCTGGAAGG - Intergenic
1168836126 20:878488-878510 TTTTCCCTCTAGCAGGTGGAGGG - Intronic
1169182060 20:3578125-3578147 TTTTCATATCATCAGGTGGAAGG - Intronic
1169911394 20:10650462-10650484 CTTTCCTTGTAGCAGGTGTCTGG - Intronic
1170206086 20:13800031-13800053 TTTTCCTTGTAGGGGTTGGAGGG + Intronic
1170386214 20:15820181-15820203 TTTTCTTTTTGGCAGGAGTAGGG + Intronic
1170697960 20:18676987-18677009 TTTTCTTTTTAGGGGGTGGGAGG - Intronic
1172821572 20:37739742-37739764 TGTTCCTTTTAGGAGATGGACGG + Intronic
1173271988 20:41545392-41545414 TTTTCCTTTTTGGAGGAGGGAGG + Intronic
1173892584 20:46524533-46524555 TTTTTCTTTCAGCAGGAGAAAGG + Intergenic
1174567607 20:51477774-51477796 TTTGCCTTTTGGCAGGTGACTGG - Intronic
1174976241 20:55338777-55338799 TTTTCCTTTTGCCAGATGAATGG + Intergenic
1176018976 20:62953029-62953051 TGTTCCTTGTGGGAGGTGGAAGG + Intronic
1176214870 20:63943220-63943242 TTTCCCTGGTTGCAGGTGGAGGG - Intronic
1177578689 21:22992076-22992098 TTTTGCTTGTAGAAGGTTGAAGG + Intergenic
1177679969 21:24354458-24354480 TTATCCTGTCAGCAGGTAGAAGG + Intergenic
1177849788 21:26332858-26332880 TTTTCCTCTTTTCAAGTGGAAGG - Intergenic
1178215523 21:30592980-30593002 TTCTCCTTTTATCAGGATGATGG + Exonic
1178428863 21:32501734-32501756 TTTTCCTTTTAGGAAGTGAGAGG - Intronic
1178858375 21:36269030-36269052 TTTTCTTTTTAGGAGGTGGTGGG - Intronic
1179439780 21:41385259-41385281 TTTTCCTTTTAGTTGAAGGAAGG + Intronic
1179452607 21:41475929-41475951 TTTTCATTTGAAGAGGTGGAAGG - Intronic
1179817421 21:43916672-43916694 TTGTCCTTTTAGTAGGTGATTGG + Intronic
1180030183 21:45201566-45201588 TTTCCATTTTGGAAGGTGGAAGG + Intronic
1181133194 22:20746546-20746568 TTTTCCTTTTTGGGGGTGGTAGG - Intronic
1181389545 22:22570244-22570266 TTTTCCTTCTAGCATAGGGAGGG + Intergenic
1181850847 22:25748960-25748982 TTGTCCATTTAGCCTGTGGATGG + Intronic
1183846946 22:40549537-40549559 GTTTCCTTTGAGCAAGGGGAAGG + Intronic
1185007034 22:48285634-48285656 TTTTTTTTTTTGCATGTGGATGG - Intergenic
1185120547 22:48966038-48966060 TTTTCTTTTTTGGAGGGGGAAGG - Intergenic
1185319899 22:50195821-50195843 GTTTCCTTTGAACAGGGGGAAGG - Intronic
949161066 3:882576-882598 TTTTCATTTTAGCTGGGGCAGGG - Intergenic
949499073 3:4661580-4661602 GTTTTCTTTTAACAAGTGGAAGG + Intronic
950945621 3:16942736-16942758 TTTGCTTTTAAGGAGGTGGAAGG - Intronic
951123127 3:18951664-18951686 TTTCCCTTCAAGCAGGTGGAGGG + Intergenic
951161471 3:19427873-19427895 AATTCCTATTTGCAGGTGGAAGG + Intronic
951423785 3:22518735-22518757 TTTTCCATGGACCAGGTGGAGGG + Intergenic
951444486 3:22762606-22762628 TTTTCCTTTAAGCTGCTGAATGG - Intergenic
951742884 3:25943867-25943889 AGTTCCCTTTAGCAGGTGGCAGG + Intergenic
952349411 3:32519800-32519822 TTGTCCTTTTTGGAGGCGGAGGG - Intergenic
953872022 3:46635026-46635048 TTTTCCTCTTTGCAGACGGAGGG - Intergenic
954067645 3:48119547-48119569 TTTTTCTTTTGGCAGGGGGATGG - Intergenic
954256666 3:49412108-49412130 TTTTGCTTTTAGGGCGTGGACGG - Exonic
956585195 3:70856658-70856680 TTTTTTTTTTTGCAGGGGGACGG + Intergenic
957047401 3:75386554-75386576 TTTTCCTTTTAGGAAGTGAGAGG + Intergenic
960705483 3:120476965-120476987 TTCTCCTTTCAGAAGCTGGAGGG + Intergenic
960917553 3:122712418-122712440 TTTTTCTTTTAGCAGAGAGAAGG + Intronic
961879475 3:130050665-130050687 TTTTCCTTTTAGGAAGTGAGAGG + Intergenic
961922316 3:130440481-130440503 TTCTCCATTTAGCTGTTGGAAGG - Exonic
962275699 3:134011781-134011803 TTGTCCTTTTAGAGGCTGGAGGG + Intronic
963840798 3:150104019-150104041 TGTTCCTTTTGGTAGGTGGAAGG + Intergenic
964391896 3:156206426-156206448 TTCTCCTTGTTGCAGGGGGATGG - Intronic
964463286 3:156960996-156961018 ATTTTATTCTAGCAGGTGGAAGG - Intronic
964828217 3:160853198-160853220 TTTTCTTTTTGGCAGTGGGAGGG + Intronic
965172204 3:165280047-165280069 TTTTCCTTTTAGGAAGTGACAGG - Intergenic
965501998 3:169468180-169468202 TTTTCCTTTTAGCTGCTCAAAGG + Intronic
966243883 3:177784507-177784529 TTTTCTTTTTGGCATGTGCATGG - Intergenic
966554370 3:181242677-181242699 TTTCCCTCTAAGCATGTGGATGG + Intergenic
967189024 3:186969358-186969380 TTTTCATTTTAATAGGTGTATGG + Intronic
967566145 3:190975624-190975646 TTTTGCTTTTTGCGGGTGCAGGG + Intergenic
968897107 4:3410833-3410855 TTTTCCTTTTGGCTTGTTGATGG + Intronic
968991685 4:3917569-3917591 TTTTCCTTTTAGGAAGTGAGAGG + Intergenic
969624898 4:8297461-8297483 CTTTCCTTCTAGCAGGGAGACGG + Intronic
970236802 4:13967001-13967023 TTTTCCTTTTTGCAGGCATATGG - Intergenic
970621902 4:17830798-17830820 AGTCCCTTTTAGCAGGTGGAGGG + Intronic
970661032 4:18286090-18286112 TTGAGCTTCTAGCAGGTGGAAGG - Intergenic
970737203 4:19186622-19186644 TTTTAAATTTAGCAGGTGAAAGG - Intergenic
970862855 4:20723438-20723460 TTTTTGTTTTTGCAGGTGGGTGG + Intronic
970973002 4:22006557-22006579 TTTTTAATTTAGCAGGTGTAGGG - Intergenic
971055178 4:22904910-22904932 TTGTCCTTTTATCAGATTGAGGG - Intergenic
971848506 4:31950774-31950796 TTTTCCTTTTTTCACATGGAAGG + Intergenic
972289092 4:37674483-37674505 TTTTGCCTTTAGAAGGAGGATGG + Intronic
972734015 4:41822570-41822592 TTTTCCCTATAGAATGTGGAGGG + Intergenic
973827462 4:54723075-54723097 TTCTCCTTTTTGGGGGTGGAAGG - Intronic
976513862 4:85941727-85941749 TTTTCCTTTTAGGAAGGGAATGG - Intronic
977111509 4:92962467-92962489 TTTTCCTTCTCCCAGTTGGAAGG + Intronic
977656635 4:99529327-99529349 TCTTCCCTTTATCAGTTGGAAGG - Intronic
978326269 4:107560714-107560736 TTTTTCTTTTATCAGGTGGAAGG + Intergenic
978369716 4:108018084-108018106 TTCCCCTTTTTGCAGGTGAATGG + Intronic
979973949 4:127172717-127172739 TTTTTTTTTTTGCTGGTGGAGGG - Intergenic
980257017 4:130394833-130394855 TTTTCCTTTGAGCAGGAGGTGGG + Intergenic
981400163 4:144304318-144304340 ATTTTATTTTTGCAGGTGGAGGG - Intergenic
982141358 4:152322808-152322830 TTTTTCTTTTTGCAGGGGGAAGG + Exonic
982767037 4:159360852-159360874 TTTTCCTGTTAGCTTCTGGAGGG - Intergenic
983388499 4:167098209-167098231 TCTTGGTTCTAGCAGGTGGAGGG - Intronic
984142894 4:176024584-176024606 TTCTCCTTTTAGCAGGTGACAGG - Intergenic
984258057 4:177410564-177410586 TTTTCCTTTGGACAGGTGTAAGG + Intergenic
984882358 4:184421255-184421277 TTTTCCTTTTAACAGGTTTTGGG - Intronic
985218576 4:187678469-187678491 ATTTCCACTTAGCAAGTGGAAGG + Intergenic
986438144 5:7755381-7755403 TTTTCCTATCAGGAGCTGGAAGG + Intronic
988682290 5:33495810-33495832 TTTTCCTTTTTTCAGTGGGAGGG - Intergenic
989017777 5:36959426-36959448 CTTGCCTTTTAGCAAGTTGAAGG + Intronic
989017962 5:36962456-36962478 TTGTCATTTTAGGAGGTGAAAGG + Intronic
990283554 5:54277264-54277286 TTTTCTTTTTTGCGGGGGGAGGG - Intronic
990327180 5:54690072-54690094 TTTCCCTTTCCCCAGGTGGAAGG + Intergenic
992031036 5:72721700-72721722 TTTTCCTTTGTGCATGCGGATGG - Intergenic
992365820 5:76088343-76088365 TTTTTGTTATAGCAGCTGGAAGG - Intronic
993003545 5:82406693-82406715 TTTTCCTTTGATAAGGTGGCTGG + Intergenic
993464019 5:88222460-88222482 TTTTTTTCTTAGCAGGGGGAAGG - Intronic
994012942 5:94928830-94928852 TTTTTCTTTTTGGAGGTGGGGGG - Intronic
995241292 5:109887484-109887506 TTTTCCTTTGAGCACCTGGTAGG + Intergenic
996469714 5:123845424-123845446 TCAACCATTTAGCAGGTGGAAGG + Intergenic
996529780 5:124516166-124516188 TTTTCCTTTTGGCAAGGCGATGG - Intergenic
997969398 5:138388245-138388267 TTTTCTTTTAAACAGGTTGAGGG + Intronic
998118395 5:139556688-139556710 TTTTCCTTTTATTAGGTTAATGG - Intronic
999047121 5:148481548-148481570 TTTTCTTTTTGGCATTTGGATGG + Exonic
1000413411 5:160958168-160958190 TTTTAGTTTTAGCAGCTAGAAGG - Intergenic
1001982327 5:176045788-176045810 TTTTCCTGTTGGCAGCAGGATGG + Intergenic
1002235134 5:177798269-177798291 TTTTCCTGTTGGCAGCAGGATGG - Intergenic
1002371356 5:178757558-178757580 TTTGCATTTGAGCTGGTGGATGG + Intergenic
1002490921 5:179576885-179576907 TTTTTCTTCTAGAAGGTGGTAGG + Intronic
1002573419 5:180157307-180157329 ATTTCTTTTTAGCACTTGGATGG - Intronic
1003603174 6:7536983-7537005 TTTTCATTTTTGCTGGGGGAGGG - Intergenic
1003628280 6:7763754-7763776 CTTTCCTTTTAGCAGGGCCAAGG - Intronic
1004069951 6:12288773-12288795 TTTTGATTTTAGAAGGAGGAGGG + Intergenic
1004687956 6:17965547-17965569 TTCTCTTTTTAGCAGCAGGAAGG + Intronic
1005091076 6:22057541-22057563 TTTTTTTTTTGGCAGGGGGAAGG + Intergenic
1005393098 6:25353849-25353871 TTTTCATTTTAGCTTCTGGAGGG + Intronic
1005792177 6:29314706-29314728 TTTTCCTTTTATTATGTGGTTGG + Intergenic
1006708194 6:36040428-36040450 TCTGCCTTTTTGCAGGTGGAAGG - Intronic
1007577928 6:42938178-42938200 TTTTCCCTTCAGCACGTGGTTGG - Exonic
1008092457 6:47307760-47307782 TTTACCTTTTAGCATGAGGTAGG - Intronic
1008620756 6:53269553-53269575 TTTGCCTTTTAGTATCTGGATGG + Intronic
1012269616 6:97192666-97192688 TTTGCCAATTAGCAGTTGGATGG + Intronic
1012332600 6:98011631-98011653 TTGTGCTTCTAGCAGGAGGAGGG - Intergenic
1012431956 6:99173153-99173175 TTTTCCTTTTACCAGTTAGGCGG - Intergenic
1012711980 6:102618150-102618172 TTTTTTTTTTAACTGGTGGAGGG - Intergenic
1013306279 6:108849395-108849417 TTCTCCTTTTAAAAGGTGGGTGG - Intronic
1013542876 6:111128688-111128710 TGTTCCTTATAGAAGATGGAAGG + Intronic
1014739650 6:125133593-125133615 TTTTGCTTATAGCATGAGGAAGG - Intronic
1014776535 6:125517277-125517299 TTTTTTTTTTAGAGGGTGGAGGG + Intergenic
1015509019 6:134019098-134019120 TTTCACTTTGAGCAGATGGAAGG - Intronic
1016101424 6:140105868-140105890 TTTTCCTTTTCCCATGTGGAAGG + Intergenic
1016865495 6:148761732-148761754 GTCACCTCTTAGCAGGTGGAGGG + Intronic
1017163601 6:151389249-151389271 TTTTCCTTTTAGTAAGAGGCAGG - Intronic
1017571949 6:155754541-155754563 TTTTCCTTTTAGAAGGATAATGG + Intergenic
1017689318 6:156947431-156947453 TTTTCTTTTTTGCAGATGTAGGG + Intronic
1018519952 6:164637049-164637071 TTTACTTGTTATCAGGTGGAAGG - Intergenic
1020314491 7:6895352-6895374 TTTTCCTTTTAGGAAGTGAGAGG + Intergenic
1020454907 7:8360850-8360872 TTTTCGTTTTAGCAACTGGAAGG - Intergenic
1021168316 7:17367982-17368004 TTCTCCTTCTAGGAGGTGGAAGG + Intergenic
1021213460 7:17886056-17886078 TTTGCCTTTTAACAAGTGTAGGG + Intronic
1021241136 7:18202531-18202553 ACTTCCTTTTAGTAGGTTGAGGG + Intronic
1021482946 7:21137776-21137798 TTTTCTTTTTAGTTGCTGGAGGG + Intergenic
1022691788 7:32663256-32663278 TTTTCCTTAAAACAGGTGGAGGG + Intergenic
1022919450 7:34997805-34997827 TTTTCCTTAAAACAGGTAGAGGG + Intronic
1023126858 7:36962747-36962769 CTTTCCTTTTTGCAGAAGGAAGG - Intronic
1026312660 7:69200927-69200949 TCTTCCTCTTAGCAGCTGCATGG - Intergenic
1026825179 7:73577253-73577275 TTTTTTTTTTTGCAGGGGGACGG - Intronic
1028178153 7:87681619-87681641 ATTACCTTTTTGCTGGTGGAGGG + Intronic
1028627400 7:92892883-92892905 GTTTCCTTTTGGCAGGTGGTGGG - Intergenic
1028665024 7:93332274-93332296 CTTTCCTTTGATCATGTGGAAGG + Intronic
1029538482 7:101169577-101169599 CATTCCTTTTACCAGGTGGAGGG + Intergenic
1030507619 7:110444819-110444841 TTTTCTTTTTTGAAGGGGGATGG - Intergenic
1030547248 7:110911934-110911956 TTCTCCTTTTAAAAGGTAGAAGG + Intronic
1031299803 7:120050878-120050900 TTTTCTTTTTTGCAGGGGAATGG + Intergenic
1031444254 7:121831400-121831422 TTTTGCTTTTACCAGTTGCATGG + Intergenic
1032781563 7:135168635-135168657 TTGAGCTTTTAGAAGGTGGAGGG - Intronic
1033313660 7:140280625-140280647 TTTTCTTTTTGGCAGGGAGATGG - Intergenic
1033560429 7:142525639-142525661 TTTTCGTTTAAGTAGTTGGAAGG + Intergenic
1034120386 7:148621445-148621467 CTTTCCTCTTAGGAGGTGGGGGG - Intergenic
1034834863 7:154342793-154342815 TTTAACTTTTAGGAAGTGGACGG - Intronic
1035458143 7:159022945-159022967 TTTACCTTTTAACAGGATGAGGG - Intergenic
1036440035 8:8773753-8773775 TTTTTCTTTTACCAGGAGGGAGG - Intergenic
1037121041 8:15287246-15287268 ATTTCGTTTTAGCAGCTGGAAGG + Intergenic
1037744003 8:21629062-21629084 TTTTCCTTTAACCAGTTGGCCGG + Intergenic
1037762241 8:21749228-21749250 TTTTTTTTTTTGCAGGGGGAGGG - Intronic
1038815756 8:30902370-30902392 TTTTGCTTTTTGCAGGGGGAGGG + Intergenic
1039949116 8:42153663-42153685 TTTTTTTTTTTGGAGGTGGAGGG + Intronic
1040388846 8:46932883-46932905 TTGTCCTGTGAGCAGCTGGAAGG - Intergenic
1040416343 8:47199001-47199023 TTTTCCTCTGAGAAGGTGGACGG - Intergenic
1040440217 8:47433595-47433617 TTTTTCTTTTGGCATTTGGAAGG + Intronic
1040851268 8:51902387-51902409 TTTTTTTTTTTGCAGGGGGAGGG - Intergenic
1041044520 8:53878427-53878449 TTTTTCTTTTGGAAAGTGGAGGG - Intronic
1041895401 8:62918438-62918460 TTTTCCCTTTTGCAGTTGGTGGG + Exonic
1042400520 8:68341033-68341055 TTTTCATTATAGCAGCTGGAAGG - Intronic
1043669468 8:82863892-82863914 TTATTCTTTTAGAAGGGGGAAGG - Intergenic
1043910393 8:85857400-85857422 TTTTATTTTTAGGGGGTGGAAGG - Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1044523171 8:93223152-93223174 TTTTCCTTCAAGCATTTGGAAGG - Intergenic
1044549095 8:93492551-93492573 TTTTTTTTTTAGCAGAGGGAAGG - Intergenic
1045464914 8:102460978-102461000 TCTTCATCTTCGCAGGTGGAAGG - Intergenic
1045776657 8:105811682-105811704 TTTACATTGTAGCAGGAGGACGG - Intergenic
1046272028 8:111909383-111909405 TTTTCCTTTTGGCAGGGAGATGG - Intergenic
1046534017 8:115485246-115485268 TTTTCCTTGTAGCTGTTGGCCGG - Intronic
1046713845 8:117545658-117545680 TTTTTCTTTCAGATGGTGGAGGG + Intergenic
1046755305 8:117967011-117967033 TTTTCATTTGGGCAGGTTGAGGG - Intronic
1047354896 8:124111264-124111286 TTTTCCCTTTAGGAGGTGTAAGG - Intronic
1048185219 8:132234356-132234378 TTTTTTTTTTGGCAGGTGAAAGG + Intronic
1048623032 8:136155545-136155567 TTTTCTCTTGGGCAGGTGGAAGG + Intergenic
1049255993 8:141614191-141614213 TCTTCCTTGGAGCAGGGGGAGGG + Intergenic
1050485282 9:6128045-6128067 TTTTCCTTTAATCAGGAGAAGGG + Intergenic
1051359544 9:16269753-16269775 TTATCCTTTGTGCAAGTGGAAGG - Intronic
1052479663 9:29007705-29007727 TTTTTATTTTAGTAGCTGGATGG + Intergenic
1056558620 9:87710413-87710435 GATTCCTTTTAGAAGGTGTAGGG - Intergenic
1057813221 9:98273788-98273810 TATTCCTTTTAACAGCTGAACGG + Intergenic
1059045979 9:110867220-110867242 TTTGGCTTTTGGAAGGTGGAGGG + Intergenic
1059222043 9:112632282-112632304 TTTTCATGTTAGCATGTAGAAGG + Intronic
1059284922 9:113164262-113164284 TTGTCTTTGTAGCAGATGGATGG - Intronic
1059356868 9:113706612-113706634 GTTTCCTGTTACCAGTTGGAGGG - Intergenic
1059517891 9:114912868-114912890 TTTTCTTTTTAGCAAGTGGAGGG + Intronic
1060066391 9:120504815-120504837 TTGTACTTTTTCCAGGTGGAGGG - Intronic
1186375936 X:9001324-9001346 TTTTCCTTCTAGCAGATTTATGG - Intergenic
1187007849 X:15249607-15249629 TTTTCATTTTACCAGAGGGATGG - Intronic
1187109808 X:16285369-16285391 TTTTTCCTTTAGCTGGTAGAGGG + Intergenic
1188891766 X:35620015-35620037 TTTTCCTTTTGGAATTTGGATGG + Intergenic
1189047497 X:37609194-37609216 ATTTCTTTTTAGCAGGTGGAAGG - Intronic
1189345957 X:40241652-40241674 TTTTGCGGTTTGCAGGTGGAGGG - Intergenic
1190417326 X:50192866-50192888 TTCTCCTTTTGACAGGTGGATGG + Exonic
1192091247 X:68158736-68158758 TTTTCCCTCTAGCAGGTGATTGG + Intronic
1193746925 X:85293506-85293528 TTGGCCTTTTAGAAGGTGGAAGG + Intronic
1193823323 X:86193221-86193243 GTTTTCTTTTAGTAGGTGTAAGG + Intronic
1194337102 X:92661172-92661194 ATTTCCTTTTAATGGGTGGAGGG + Intergenic
1194492391 X:94568077-94568099 TTTTCCTTTCTGCAAGTGGAAGG + Intergenic
1195873680 X:109515105-109515127 TTTTTCTTCTAGCAGTTTGATGG - Intergenic
1196459813 X:115918385-115918407 TTTCCCTTTCTGAAGGTGGACGG + Intergenic
1197832881 X:130663594-130663616 ATTGCCTTTTTGCAGGAGGAAGG - Intronic
1198726802 X:139686635-139686657 TTTTGGCTTTAGCAAGTGGATGG - Intronic
1199336525 X:146624347-146624369 TTTTCTTATTTGCAGGAGGATGG - Intergenic
1199479680 X:148284455-148284477 TTCTTCTTTTACCTGGTGGATGG + Intergenic
1199562213 X:149175469-149175491 TTTTCCTTTGTTGAGGTGGAGGG - Intergenic
1200645530 Y:5777911-5777933 ATTTCCTTTTAATGGGTGGAGGG + Intergenic
1201533308 Y:15016572-15016594 TTTTCCTTTTAGTATTTGGAAGG - Intergenic
1201624860 Y:16003836-16003858 TCTTGCTTTGGGCAGGTGGAAGG - Intergenic
1201993799 Y:20060290-20060312 TCTTCCTTCTGGCAGGTGCATGG + Intergenic
1201993894 Y:20061597-20061619 TATTCCTTTTGGCAGGTTCATGG - Intergenic
1201994292 Y:20067112-20067134 TTTTCCTTCTGGCAGGTTCATGG - Intergenic
1201995365 Y:20081496-20081518 TCTTCCTTTTGGCAGGTTCATGG - Intergenic
1201995446 Y:20082499-20082521 TATTCCTTTTGGCAGGTTCATGG - Intergenic
1201996054 Y:20090759-20090781 TCTTCCTTTTGGCAGGTACATGG + Intergenic
1201996176 Y:20092391-20092413 TCTTCCTTTTGGCAGGTACATGG + Intergenic
1201996367 Y:20094901-20094923 TCTTCCTTCTAGCAGGTTCATGG + Intergenic
1201996531 Y:20097074-20097096 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1201996573 Y:20097573-20097595 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1201996665 Y:20098698-20098720 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1201996861 Y:20101207-20101229 TTTTCCTTCTGGCAGGTTCATGG + Intergenic
1201996964 Y:20102589-20102611 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1201997120 Y:20104725-20104747 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1201997137 Y:20104975-20104997 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1201997214 Y:20105975-20105997 TATTCCTTTTGGCAGGTTCATGG + Intergenic
1201997761 Y:20113121-20113143 TCTTCCTTTTGGCAGGTACATGG + Intergenic
1201997934 Y:20115511-20115533 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1201998026 Y:20116636-20116658 TCTTCCTTTTGGCAGGTACATGG + Intergenic
1201998224 Y:20119395-20119417 TCTTCCTTCTGGCAGGTGAATGG + Intergenic
1201998760 Y:20126253-20126275 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1201999257 Y:20133129-20133151 TCTTCCTTCTAGCAGGTTCATGG + Intergenic
1201999268 Y:20133254-20133276 TCTTCCTTTTGGCAGGTACATGG + Intergenic
1201999600 Y:20137759-20137781 TCTTCCTTCTAGCAGGTTCATGG + Intergenic
1201999724 Y:20139256-20139278 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1202000030 Y:20143390-20143412 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1202000106 Y:20144390-20144412 TATTCCTTTTGGCAGGTTCATGG + Intergenic
1202000269 Y:20146648-20146670 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1202000529 Y:20150219-20150241 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1202000546 Y:20150469-20150491 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1202000682 Y:20152220-20152242 TCTTCCTTCTGGCAGGTGAATGG + Intergenic
1202000709 Y:20152595-20152617 TCTTCCTTCTAGCAGGTTCATGG + Intergenic
1202000720 Y:20152720-20152742 TCTTCCTTTTGGCAGGTACATGG + Intergenic
1202001979 Y:20169459-20169481 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1202002055 Y:20170459-20170481 TATTCCTTTTGGCAGGTTCATGG + Intergenic
1202002255 Y:20173220-20173242 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1202002537 Y:20177228-20177250 TATTCCTTTTGGCAGGTTCATGG + Intergenic
1202002649 Y:20178732-20178754 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1202002755 Y:20180110-20180132 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1202002785 Y:20180489-20180511 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1202003114 Y:20184866-20184888 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1202003273 Y:20187004-20187026 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1202003290 Y:20187254-20187276 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1202003428 Y:20189005-20189027 TCTTCCTTCTGGCAGGTGAATGG + Intergenic
1202003468 Y:20189505-20189527 TCTTCCTTTTGGCAGGTACATGG + Intergenic
1202003690 Y:20192507-20192529 TCTTCCTTTTGGCAGGTACATGG + Intergenic
1202003870 Y:20194897-20194919 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1202004367 Y:20201150-20201172 TCTTCCTTTTAGCAGGTTCATGG + Intergenic
1202007737 Y:20295910-20295932 TTTTCCTTCTGGCAGGTTCATGG + Intergenic
1202008350 Y:20304134-20304156 TCTTCCTTCTAGCAGGTTCATGG + Intergenic
1202009416 Y:20317852-20317874 TCTTCCTTTTGGCAGGTTCAGGG + Intergenic
1202011009 Y:20338730-20338752 TCTTCCTTTTAGCAGGTTCATGG + Intergenic
1203336433 Y_KI270740v1_random:6231-6253 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1203336440 Y_KI270740v1_random:6356-6378 TCTTCCTTCTGGCAGGTGCATGG + Intergenic
1203336958 Y_KI270740v1_random:13356-13378 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1203337110 Y_KI270740v1_random:15371-15393 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1203337474 Y_KI270740v1_random:20258-20280 TATTCCTTTTGGCAGGTTCATGG + Intergenic
1203337556 Y_KI270740v1_random:21261-21283 TCTTCCTTTTGGCAGGTTCATGG + Intergenic
1203337724 Y_KI270740v1_random:23522-23544 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1203338097 Y_KI270740v1_random:28537-28559 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1203338139 Y_KI270740v1_random:29036-29058 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1203338511 Y_KI270740v1_random:33925-33947 TCTTCCTTCTGGCAGGTTGATGG + Intergenic
1203338604 Y_KI270740v1_random:35050-35072 TCTTCCTTTTGGCAGGTTCATGG + Intergenic