ID: 1083253084

View in Genome Browser
Species Human (GRCh38)
Location 11:61481058-61481080
Sequence CCTAGAAGGTCTCAGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 226}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083253076_1083253084 -4 Left 1083253076 11:61481039-61481061 CCCCTCAGTGGGCCCTGGCCCTA 0: 1
1: 0
2: 1
3: 18
4: 181
Right 1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 226
1083253077_1083253084 -5 Left 1083253077 11:61481040-61481062 CCCTCAGTGGGCCCTGGCCCTAG 0: 1
1: 0
2: 0
3: 24
4: 206
Right 1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 226
1083253068_1083253084 15 Left 1083253068 11:61481020-61481042 CCCCTCCTGGCCAGGTCAGCCCC 0: 1
1: 0
2: 7
3: 56
4: 489
Right 1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 226
1083253066_1083253084 19 Left 1083253066 11:61481016-61481038 CCCTCCCCTCCTGGCCAGGTCAG 0: 1
1: 0
2: 7
3: 53
4: 471
Right 1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 226
1083253078_1083253084 -6 Left 1083253078 11:61481041-61481063 CCTCAGTGGGCCCTGGCCCTAGA 0: 1
1: 0
2: 0
3: 23
4: 213
Right 1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 226
1083253069_1083253084 14 Left 1083253069 11:61481021-61481043 CCCTCCTGGCCAGGTCAGCCCCT 0: 1
1: 0
2: 3
3: 44
4: 375
Right 1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 226
1083253074_1083253084 5 Left 1083253074 11:61481030-61481052 CCAGGTCAGCCCCTCAGTGGGCC 0: 1
1: 0
2: 0
3: 14
4: 208
Right 1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 226
1083253070_1083253084 13 Left 1083253070 11:61481022-61481044 CCTCCTGGCCAGGTCAGCCCCTC 0: 1
1: 0
2: 1
3: 54
4: 475
Right 1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 226
1083253071_1083253084 10 Left 1083253071 11:61481025-61481047 CCTGGCCAGGTCAGCCCCTCAGT 0: 1
1: 0
2: 2
3: 23
4: 355
Right 1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 226
1083253067_1083253084 18 Left 1083253067 11:61481017-61481039 CCTCCCCTCCTGGCCAGGTCAGC 0: 1
1: 0
2: 6
3: 79
4: 688
Right 1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083253084 Original CRISPR CCTAGAAGGTCTCAGAAGCC TGG Intronic