ID: 1083253084

View in Genome Browser
Species Human (GRCh38)
Location 11:61481058-61481080
Sequence CCTAGAAGGTCTCAGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 226}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083253077_1083253084 -5 Left 1083253077 11:61481040-61481062 CCCTCAGTGGGCCCTGGCCCTAG 0: 1
1: 0
2: 0
3: 24
4: 206
Right 1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 226
1083253074_1083253084 5 Left 1083253074 11:61481030-61481052 CCAGGTCAGCCCCTCAGTGGGCC 0: 1
1: 0
2: 0
3: 14
4: 208
Right 1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 226
1083253069_1083253084 14 Left 1083253069 11:61481021-61481043 CCCTCCTGGCCAGGTCAGCCCCT 0: 1
1: 0
2: 3
3: 44
4: 375
Right 1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 226
1083253076_1083253084 -4 Left 1083253076 11:61481039-61481061 CCCCTCAGTGGGCCCTGGCCCTA 0: 1
1: 0
2: 1
3: 18
4: 181
Right 1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 226
1083253070_1083253084 13 Left 1083253070 11:61481022-61481044 CCTCCTGGCCAGGTCAGCCCCTC 0: 1
1: 0
2: 1
3: 54
4: 475
Right 1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 226
1083253078_1083253084 -6 Left 1083253078 11:61481041-61481063 CCTCAGTGGGCCCTGGCCCTAGA 0: 1
1: 0
2: 0
3: 23
4: 213
Right 1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 226
1083253067_1083253084 18 Left 1083253067 11:61481017-61481039 CCTCCCCTCCTGGCCAGGTCAGC 0: 1
1: 0
2: 6
3: 79
4: 688
Right 1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 226
1083253066_1083253084 19 Left 1083253066 11:61481016-61481038 CCCTCCCCTCCTGGCCAGGTCAG 0: 1
1: 0
2: 7
3: 53
4: 471
Right 1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 226
1083253068_1083253084 15 Left 1083253068 11:61481020-61481042 CCCCTCCTGGCCAGGTCAGCCCC 0: 1
1: 0
2: 7
3: 56
4: 489
Right 1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 226
1083253071_1083253084 10 Left 1083253071 11:61481025-61481047 CCTGGCCAGGTCAGCCCCTCAGT 0: 1
1: 0
2: 2
3: 23
4: 355
Right 1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083253084 Original CRISPR CCTAGAAGGTCTCAGAAGCC TGG Intronic
900120170 1:1045469-1045491 CCTCGAAAGTTCCAGAAGCCAGG - Exonic
900212287 1:1462044-1462066 CACAGAAGGACTCAGAAACCGGG - Intronic
900224962 1:1528695-1528717 CACAGAAGGACTCAGAAACCGGG - Intronic
902987584 1:20164519-20164541 CCTAGAAGGAATCAGGAGGCAGG + Intronic
903592763 1:24469747-24469769 CCTAGAAGGGCACAGATGACTGG - Intronic
904353545 1:29924301-29924323 CCTGGAAGGACTCAGAGGCCAGG - Intergenic
904524263 1:31120839-31120861 TCTAGAAGGTGTCAGAACCCTGG - Intergenic
904808188 1:33146355-33146377 CCTAGCAGGTCACAGAGGCCTGG + Exonic
905451489 1:38059938-38059960 CCTTGCAGGGCCCAGAAGCCTGG - Intergenic
906933595 1:50192407-50192429 CCCTGAAGGTCACAGAAGCAGGG + Intronic
907713191 1:56903537-56903559 CCAAAAAGGTCTCAAAAGGCTGG - Intronic
908044783 1:60156980-60157002 CTTAGAAAGTCTGAGAAGGCTGG + Intergenic
908174444 1:61540492-61540514 CCTGGAGGGTCAGAGAAGCCTGG - Intergenic
909439904 1:75685650-75685672 ACTCGAAGGGCTCAGAAGACAGG - Intergenic
910712247 1:90193969-90193991 CTGAAAAGGTCTCTGAAGCCAGG + Intergenic
915603626 1:156937664-156937686 TCTAGAAGGTCTCGGGAGCAGGG - Intronic
917123778 1:171667904-171667926 CGTGGAAGGTCTAAGAGGCCTGG - Intergenic
918165946 1:181947962-181947984 CCTTGGAGGGCTCAGAAGACAGG + Intergenic
920654050 1:207861918-207861940 CCTAGAATGTTCAAGAAGCCAGG - Intergenic
921986658 1:221319627-221319649 GCCAGAAGGCCTCAGAATCCAGG - Intergenic
922134591 1:222812629-222812651 CCTAGAAAGTCTCACATGCATGG - Intergenic
922320283 1:224480840-224480862 GTTTGAAGGTCTCAGAAGACAGG - Intronic
923108697 1:230873826-230873848 CCTAGCAGGTCTCAAACTCCTGG - Intergenic
1063824432 10:9878299-9878321 CCTATAAAGTCTCAGGAGCAAGG + Intergenic
1069071038 10:63990786-63990808 CCAATAAGATCTCAGAAGCTGGG + Intergenic
1069736124 10:70655630-70655652 CCTATAAGATCTCAGGAGCTGGG - Intergenic
1070919817 10:80177472-80177494 CCCAGAAGGTCTCAGGAGACTGG - Intronic
1071603571 10:86970528-86970550 CAGAGAAGGTGTCAGAGGCCTGG - Exonic
1071990659 10:91098008-91098030 ACTTGGAGGTCTCAGAAGACAGG - Intergenic
1075573415 10:123561142-123561164 CCCAGAAGGTCTCAGTAGCTGGG - Intergenic
1078065845 11:8079107-8079129 GTTGGAAGGTCTCAGGAGCCTGG - Intronic
1078281550 11:9907238-9907260 CCGAGAAGGGCTAATAAGCCTGG - Intronic
1078934170 11:15937743-15937765 CCTAGAGGGACTTAGAGGCCTGG - Intergenic
1079542534 11:21593486-21593508 ACTTGGAGGTCTCAGAAGACAGG + Intergenic
1080888433 11:36387771-36387793 CATAAAAGGTCTGAGAAGGCTGG + Intronic
1080899328 11:36472763-36472785 CCTTGGAGATCTCAGAAGCTTGG - Intergenic
1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG + Intronic
1083674139 11:64316132-64316154 CCTAGGGGGTGTCAGAAGCTGGG + Exonic
1084561205 11:69906373-69906395 CATAGAAGGTCTTAGGAGCCTGG + Intergenic
1084618039 11:70249592-70249614 CCTAGAAGCTGGGAGAAGCCTGG - Intergenic
1087927974 11:103942243-103942265 CCTAAAAGGTCTCGAAAGGCTGG - Intronic
1088600155 11:111466935-111466957 CCTAGAAGGTCAGGGTAGCCAGG + Intergenic
1091002895 11:131925592-131925614 CCGAGGAGGTCTCAGACTCCTGG + Intronic
1092941914 12:13417844-13417866 CCTAGCATGTCTGTGAAGCCAGG - Intergenic
1094302424 12:28979883-28979905 CCCAGAAGGTCGCCTAAGCCTGG + Intergenic
1095942581 12:47736672-47736694 CCCAGAAGACCCCAGAAGCCTGG + Intronic
1096738757 12:53676705-53676727 CCTAGACTGTCCCAGGAGCCAGG - Intronic
1101335616 12:103794090-103794112 CCTAGAAAGTCTGACAATCCAGG + Intronic
1102282407 12:111628781-111628803 ACTATAAAATCTCAGAAGCCAGG - Intergenic
1103446154 12:120996533-120996555 CCTCGTAGGTCTCAGCAGCTGGG + Exonic
1105813763 13:24015668-24015690 CCTAGAAGGTCAGACCAGCCAGG + Intronic
1107298952 13:38945801-38945823 CCTAGAATGTTCCAGAGGCCAGG - Intergenic
1108092564 13:46864472-46864494 CCTCGCAGGTCTTACAAGCCAGG + Intronic
1108727007 13:53193722-53193744 CCTAGAAGGACTCAGAATGGGGG + Intergenic
1109718271 13:66245411-66245433 ACTTGAAGGGCTCAGAAGACAGG + Intergenic
1114147595 14:19995061-19995083 CCTTGGAGGGCTCAGAAGACAGG - Intergenic
1114822141 14:26033488-26033510 CCTAGAATCTCTCAGATGCTTGG + Intergenic
1114881855 14:26796134-26796156 CCAATAAGGTCTCAGGAGTCGGG + Intergenic
1115126834 14:30005686-30005708 TAGAGAAGATCTCAGAAGCCTGG - Intronic
1116959112 14:50952080-50952102 CCTGGAGGGTCTCAGTAGTCAGG + Intergenic
1118055230 14:62072923-62072945 CCTATAATTTCTAAGAAGCCAGG + Intronic
1120584190 14:86290863-86290885 CATAGATGGTTTCAGAAGTCTGG + Intergenic
1121848581 14:97197733-97197755 CCTAGGAGATCTCAGAACCTTGG - Intergenic
1125764942 15:42128497-42128519 CCTGGATGGTCTCAGACTCCTGG - Intergenic
1126255995 15:46626609-46626631 CCTTGGAGGGCTCAGAAGACAGG + Intergenic
1129674921 15:77627364-77627386 CCCAGAGGGTCTGAGAAGCTGGG - Intronic
1129704091 15:77784744-77784766 CCTACCAGGTCTAAGAACCCAGG - Intronic
1129832441 15:78679571-78679593 CCTGGCAGATCTCAGAATCCAGG - Intronic
1130916408 15:88308584-88308606 CTAAAAAGGTCTCAGAAGTCAGG + Intergenic
1131825588 15:96320965-96320987 CCTGGAAGGTGTCAGGAGCCGGG - Intergenic
1132597737 16:760950-760972 CGCAGAAGGCCTCAGAGGCCTGG + Intronic
1132796104 16:1723809-1723831 CATAAAAGGTCTGAGGAGCCTGG - Intronic
1133008900 16:2899385-2899407 CCTCAAAGGACCCAGAAGCCTGG - Intergenic
1134395337 16:13857614-13857636 CCTTGAAAGTCACAGAAACCAGG - Intergenic
1134841691 16:17406685-17406707 CCCAGCAGGCCTCAGAAGCTGGG + Intronic
1135841997 16:25885397-25885419 CCTAGAGGGTTTTAGAAACCAGG - Intronic
1138360507 16:56424662-56424684 ACTAGAAGATCTCAGAGGGCAGG - Intronic
1138840877 16:60504054-60504076 CCTTGAATTTCTCAGAATCCAGG + Intergenic
1142162157 16:88563375-88563397 CTTAGAAGGGACCAGAAGCCGGG + Intergenic
1142297465 16:89235205-89235227 CCTGGAGGGTCCCAGAAGCTTGG + Exonic
1143819530 17:9548526-9548548 CCTACAAGGACTTAGAAGCAAGG + Intronic
1144284877 17:13764196-13764218 ACTGGAAGGTCTCAGAAGCAAGG - Intergenic
1144998871 17:19289600-19289622 TCAAGAAGGTCTGAGAAGTCTGG + Intronic
1146468446 17:33105668-33105690 ACTTGAAGGGCTCAGAAGACAGG + Intronic
1146937060 17:36818556-36818578 CTTCACAGGTCTCAGAAGCCAGG + Intergenic
1147439501 17:40439061-40439083 ACTAGAGGCTCTCAGAAGACTGG - Intergenic
1148073792 17:44923750-44923772 CCAAAAAGGGCTCAGAGGCCAGG + Intergenic
1148208314 17:45793359-45793381 GCAAGAAGGTCTCAGAAGCTGGG + Intronic
1148375811 17:47145458-47145480 CTTAGTAGATCTCAGGAGCCTGG - Intronic
1148550166 17:48545358-48545380 GTTAGAAGGTTTCAGAAGCCTGG + Intergenic
1148803994 17:50254821-50254843 CCAAGATGGTCTCAAATGCCTGG + Intergenic
1149158879 17:53666995-53667017 ACTTGAAGGGCTCAGAAGACAGG + Intergenic
1151936833 17:77267027-77267049 CCCAGCAGCTGTCAGAAGCCTGG + Intergenic
1152269043 17:79313178-79313200 CCTGGAAGGTGCCAGAAGCAAGG - Intronic
1152682785 17:81677846-81677868 ACTGGAAGGCCTCAGAAGCCAGG + Intergenic
1153449430 18:5210227-5210249 CCTAGAAGGTCTTGGAACCATGG - Intergenic
1154508035 18:15061576-15061598 CCCAGAAGCTCTGAGATGCCAGG - Intergenic
1156207995 18:34906776-34906798 TCTTGAAGGGCTCAGAAGACAGG - Intergenic
1157781675 18:50445239-50445261 ACTTGGAGGTCTCAGAAGACAGG - Intergenic
1160824952 19:1075085-1075107 CCTGGAAGGACCCAGGAGCCCGG + Intronic
1161464969 19:4424254-4424276 CTCAGAAGGTCTGAGATGCCAGG - Intronic
1162931698 19:13960835-13960857 CCCAGAAGGTTCCAGAAGGCAGG - Intronic
1165070684 19:33253408-33253430 CCAAGAAGGGCTCTGGAGCCAGG - Intergenic
1165305389 19:35000185-35000207 CCTAGAAGGAGGGAGAAGCCGGG - Intronic
925904024 2:8528588-8528610 GCGAGAAGGGCTCAGAAGACAGG - Intergenic
925928051 2:8684951-8684973 CCAAGGAGGCCTCAGGAGCCCGG - Intergenic
926697952 2:15783930-15783952 ACCAGAAGCTCTCAGAAGACAGG - Intergenic
927509596 2:23636088-23636110 CCTAGAAGCTTCCAGAACCCGGG + Intronic
927872761 2:26634005-26634027 GCTAGAGGGTCTCAGAGGCAAGG - Intronic
927960039 2:27235420-27235442 GCTATAAGGTATCAGAATCCAGG + Exonic
930127682 2:47815495-47815517 ACTGGAAGGCCTCAGAAGCCAGG - Intronic
930612988 2:53563619-53563641 GCTACAAGATCTCAGAAGGCAGG - Intronic
932074565 2:68651021-68651043 TCCAGAAGGTCTCAACAGCCAGG + Intronic
932550027 2:72759512-72759534 CCCAAAAGGTCTCACAAGACTGG - Intronic
933140025 2:78780822-78780844 ACTAGAAAGTTTCAGCAGCCTGG - Intergenic
933552760 2:83794878-83794900 CCCAGATGGTCTCAGACTCCTGG - Intergenic
934083544 2:88489940-88489962 CCTAAAAGTTGTAAGAAGCCAGG + Intergenic
936427592 2:112434277-112434299 CCCAGAAGGACTCAGATGCAGGG - Intronic
936589013 2:113784965-113784987 CCTAGGAGCTCTTAAAAGCCAGG + Intergenic
937703855 2:124895414-124895436 CCAAGTTGGTCTCAAAAGCCTGG - Intronic
939133571 2:138267271-138267293 CTCACAAGGTCCCAGAAGCCTGG - Intergenic
939610522 2:144304113-144304135 TCCAAAAGGTCACAGAAGCCTGG + Intronic
940206405 2:151207196-151207218 CCTAAAATGTCCCAGAAGACTGG - Intergenic
941818603 2:169823608-169823630 CCAAGATGGTCTCAGACTCCTGG - Intronic
941892386 2:170595731-170595753 CCTTAAAGCACTCAGAAGCCAGG - Intronic
943082039 2:183267223-183267245 ACTGGAAGGCCTCAGAAGCCAGG - Intergenic
945604165 2:211907277-211907299 TCTAGATGATCTCTGAAGCCAGG + Intronic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
947872326 2:233446287-233446309 CCTAGTTGCTCCCAGAAGCCTGG + Intronic
948137565 2:235648178-235648200 ACCAGAAGGTCTCAGAAGAGAGG - Intronic
1170505967 20:17026188-17026210 CCCAGAAAGTCTCTGAAGCTTGG - Intergenic
1172011006 20:31845556-31845578 CCCAGCAGGTCCCAGCAGCCTGG - Exonic
1172497071 20:35395108-35395130 CCTAGAAGCTCTCCAAACCCAGG + Intronic
1173330260 20:42070216-42070238 CCTAGAAGCCCTCAGATTCCTGG - Intergenic
1176790044 21:13310223-13310245 CCCAGAAGCTCTGAGATGCCAGG + Intergenic
1177989229 21:28018430-28018452 CCCAGAAGCTCTGAGATGCCAGG + Intergenic
1179101246 21:38357169-38357191 CCAGGAAGGCCTCAGAAGCCTGG - Intergenic
1179597219 21:42451026-42451048 CCAAGAAGGCCCCAGGAGCCTGG + Intergenic
1179897066 21:44369093-44369115 CCTAGAAGGGCTCAGGCGTCAGG + Intronic
1179923796 21:44521682-44521704 GCAAGAAGGGCTCAGACGCCAGG + Intronic
1180737611 22:18029707-18029729 CCTATAAGCTCTCAGATGCTTGG - Intergenic
1181032714 22:20156106-20156128 CCGAGCATATCTCAGAAGCCAGG + Intergenic
1181620204 22:24085899-24085921 TCTGGAAGGACTCAGAGGCCAGG + Intronic
1182797069 22:32998635-32998657 CCTACAAGGTCTCTGGAGCCTGG - Intronic
1182912787 22:34001244-34001266 CCTCGAAGGCATCAGAAGCAAGG + Intergenic
1183105968 22:35615370-35615392 CCTGAAAGGTCCCAGAGGCCTGG - Intronic
1183599842 22:38833428-38833450 CCTAGCAGGACTCAGAACTCAGG - Intronic
1184738102 22:46410891-46410913 CCTAGAAGGTCTCAGAGGCAAGG - Intronic
1184907083 22:47495576-47495598 CCCAGAATGTGTCAGAAGCAAGG - Intergenic
1185344926 22:50306992-50307014 CACAGAAAGTCTCAGAAGCGGGG - Intronic
950407353 3:12813069-12813091 TCAAGAAGGCCTCAAAAGCCTGG - Exonic
952198589 3:31101912-31101934 CCTTGGAGGGCTCAGAAGACAGG - Intergenic
955191946 3:56769825-56769847 TCTCTAAGGTGTCAGAAGCCAGG + Intronic
955400916 3:58590981-58591003 CCTACAAGGCCTCTGCAGCCTGG + Intronic
955982530 3:64541283-64541305 CTCAGAAGATCTCAGAGGCCTGG - Intronic
959609806 3:108280496-108280518 CCTGGATGGTCTAAGAAGGCAGG - Intergenic
962344313 3:134608319-134608341 CCTGGCATGTCACAGAAGCCAGG - Intronic
966632964 3:182098825-182098847 CCTGGAAGGTCTCAGGAGTCTGG + Intergenic
966898215 3:184461651-184461673 CCATGAAGCTCTCAGAATCCAGG - Intronic
967036095 3:185649244-185649266 CCTCAAAGGGCTCAGATGCCAGG + Intronic
969064909 4:4471093-4471115 TCTAGCAGGTGTCAAAAGCCTGG + Intronic
971375027 4:26049669-26049691 CCTAGATGGACTCAGACACCAGG - Intergenic
972879434 4:43406038-43406060 ACTTGAAGGGCTCAGAAGACAGG + Intergenic
973822064 4:54670584-54670606 ACTGGAAGGCCTCAGAAGCCAGG + Intronic
975160327 4:71117335-71117357 CTTAGAAGGTCTCTGAAAACAGG + Intergenic
976266561 4:83190764-83190786 ACTGGAAGGTCTCAGAAGGCGGG - Intergenic
978112410 4:104978487-104978509 CCTGGGAGGTCTCTAAAGCCAGG + Intergenic
982740725 4:159054418-159054440 CCTAGGATTTCTGAGAAGCCAGG + Intergenic
983551181 4:169018907-169018929 CTTAGAAGGTGACAGAGGCCTGG + Intergenic
983830580 4:172321933-172321955 CTGATAAGATCTCAGAAGCCGGG + Intronic
984551353 4:181163470-181163492 CCTAGAAATGCTCATAAGCCTGG + Intergenic
984808417 4:183772481-183772503 CACAGAAGGTCTTGGAAGCCAGG - Intergenic
986770006 5:10964226-10964248 CCTAGGAAGTAACAGAAGCCTGG - Intergenic
992161785 5:74011456-74011478 CCCAGAAGGTCTCGGAATTCAGG + Intergenic
992644330 5:78797955-78797977 AGAAGAAGGCCTCAGAAGCCAGG + Intronic
993569637 5:89521548-89521570 ACTTGAAGGGCTCAGAAGACAGG - Intergenic
993749500 5:91649537-91649559 CCAATAAGATCTCAGAAGCTGGG + Intergenic
994813970 5:104559580-104559602 CCTAGAAGCTCTCAGTAGTCAGG + Intergenic
997399890 5:133594068-133594090 CCTAGAGGGTCTCTGAGCCCTGG - Intronic
999108155 5:149091989-149092011 GCTAGAAGGCCTCAGAATCATGG - Intergenic
1000352575 5:160363511-160363533 CTAACAAGGTCTCAGAAGCCAGG + Intronic
1001436635 5:171704414-171704436 CCTAGCAGCTCTCTGCAGCCTGG - Intergenic
1002860669 6:1076731-1076753 TCTAGAAGCTCCCAGAGGCCAGG - Intergenic
1006804825 6:36781257-36781279 CCTAGAAGCTCCAAGAATCCTGG + Intronic
1007074719 6:39059128-39059150 CCTAGAAGGAGGCAGGAGCCTGG + Intronic
1007730986 6:43946293-43946315 CCAGGAAGATCTCACAAGCCTGG + Intergenic
1010639099 6:78300509-78300531 CCTAGAAGTTCTCATGAGGCAGG - Intergenic
1011000274 6:82580898-82580920 CCTGGGAGGTCTCAGTAACCAGG + Intergenic
1011247170 6:85331585-85331607 CATAAAAGATCTCAGAGGCCGGG - Intergenic
1012575561 6:100793053-100793075 CCTACAAGATCTGAAAAGCCTGG + Intronic
1013607744 6:111765967-111765989 CATAAAAGGCCTCAGATGCCAGG + Intronic
1014375144 6:120662748-120662770 GCTAGAAGTAATCAGAAGCCAGG - Intergenic
1014545905 6:122734953-122734975 CCTGGAAGCTGTAAGAAGCCTGG + Intergenic
1014721377 6:124921566-124921588 ACTTGGAGGTCTCAGAAGACAGG - Intergenic
1014830738 6:126099974-126099996 CCTGGCAGGTCTCAGCAGCCTGG + Intergenic
1015177870 6:130330645-130330667 GCTAGAAGAACTAAGAAGCCAGG + Intronic
1016367901 6:143338625-143338647 CAGAGAAGACCTCAGAAGCCTGG - Intronic
1016373756 6:143399645-143399667 CCTAGAATCTCTCAGAATACCGG + Intergenic
1016782070 6:147969812-147969834 CCTAGAAGGTATCTGGAGTCAGG + Intergenic
1017041319 6:150310389-150310411 CCTGGAGGGTCTCAGCAGCCAGG + Intergenic
1018174149 6:161164441-161164463 CCAGGAAGGTATTAGAAGCCTGG + Intronic
1018891727 6:167987681-167987703 CCTCGAAGGCCCCACAAGCCAGG + Intergenic
1019864274 7:3690952-3690974 TCTAGAAGGTCACAGAGTCCTGG - Intronic
1020655568 7:10924715-10924737 CATAAAAGGTCTCAGAGGACTGG + Intergenic
1020656946 7:10939841-10939863 CGTAGAGGGTCACAGAGGCCTGG + Intronic
1020775553 7:12450117-12450139 GTTTGAAGGTCTCAGAAGACAGG + Intergenic
1023167366 7:37356063-37356085 ACTGGAAGGTCTCAGAACCAAGG + Intronic
1023747169 7:43332309-43332331 TTTAGAGGGTCTCAGCAGCCCGG - Intronic
1024123937 7:46272501-46272523 CCAAGAAAGCCTGAGAAGCCAGG - Intergenic
1025613335 7:63096977-63096999 CCTAGAAATTCTCATCAGCCAGG - Intergenic
1026994192 7:74605298-74605320 CGTGGAAGGCCTCATAAGCCGGG + Intergenic
1031589632 7:123573687-123573709 CCTGGAAGGATACAGAAGCCAGG - Intronic
1032861249 7:135881716-135881738 CCTAGATGGTCTCAAACTCCTGG - Intergenic
1033556656 7:142493952-142493974 GAGAGAAGGTCTCAGAAGACAGG - Intergenic
1033559015 7:142513411-142513433 GTTAGAAGGTCTCAGAAGACAGG - Intergenic
1036009233 8:4702288-4702310 CCATGCAGGTCTCAGAAGCAAGG - Intronic
1036627031 8:10480586-10480608 CCAAGAATGTACCAGAAGCCAGG + Intergenic
1036824025 8:11962430-11962452 CCAAGAAGGTCTCAAACTCCTGG - Intergenic
1037289520 8:17336257-17336279 CCTAAAAGGGCTCAGCCGCCGGG - Intronic
1039542976 8:38386679-38386701 ACTGGAAGCTGTCAGAAGCCTGG - Intronic
1039784799 8:40824834-40824856 CCTAGTAGCTCTCAGCATCCTGG + Intronic
1041377730 8:57219814-57219836 CCAAGAAGGTATCAGGAGGCAGG - Intergenic
1041393828 8:57372330-57372352 CCAATAAGGTCTCAGAAGTTGGG + Intergenic
1046319821 8:112558114-112558136 ATTAGAAGGCCTCAGAAGCAAGG + Intronic
1046851270 8:118975890-118975912 GATAGAAGGACCCAGAAGCCTGG - Intergenic
1047361562 8:124174069-124174091 CCCACAAGTTCTCAGATGCCGGG - Intergenic
1048046643 8:130779096-130779118 CTTAGAAGGTCTCAGCTACCAGG - Intergenic
1049807297 8:144546812-144546834 CAGAGAAGGCCTCAGCAGCCTGG - Intronic
1050411550 9:5371548-5371570 CTGGGAAGGTCTCAGAATCCTGG - Intronic
1051903370 9:22066542-22066564 CTTAGAAATTCTCAGAAGCTAGG - Intergenic
1056410308 9:86319593-86319615 CCTAGAAAGTTTCATAAGACAGG - Exonic
1058529227 9:105889349-105889371 AGTAGAAGGTCCCAGCAGCCAGG - Intergenic
1058774165 9:108267512-108267534 CCATGGAGGTCTCAGAATCCTGG - Intergenic
1061674885 9:132210044-132210066 TCTAGAAGGTGTTAGAAGCAGGG - Intronic
1061995496 9:134180870-134180892 CCCACAGGGCCTCAGAAGCCAGG - Intergenic
1062170230 9:135130842-135130864 ACTGGAAGGTGCCAGAAGCCGGG - Intergenic
1062406869 9:136400794-136400816 CTTAGAAGCTCTCAGGAGCCAGG - Intergenic
1062513466 9:136920716-136920738 CCTGGAAGGTCCTAGAGGCCAGG + Intronic
1185433065 X:20409-20431 CCTAGGAGGTCTCAGCACCGAGG - Intergenic
1185433089 X:20562-20584 CCTAGAAGGTCTCAGTACCTAGG - Intergenic
1186302723 X:8218111-8218133 CCTATCCTGTCTCAGAAGCCTGG - Intergenic
1186679411 X:11855758-11855780 ACTTGAAGGGCTCAGAAGACAGG - Intergenic
1187821158 X:23289862-23289884 CATAGTTGGTCTCACAAGCCTGG + Intergenic
1189419906 X:40847604-40847626 CCAATAAGATCTCAGAAGCTGGG + Intergenic
1191104567 X:56764472-56764494 CCTTCAAGGGCTCAGAACCCCGG + Intergenic
1191688103 X:63913348-63913370 ACTAGGAGGGCTCAGAAGACAGG + Intergenic
1194153204 X:90352256-90352278 CCCAGAAGTGCTCAGAAGCTAGG + Intergenic
1196414305 X:115454636-115454658 CCTGGAAGGTCTCAAAAGCCCGG + Intergenic
1197181806 X:123544654-123544676 CTTAGAATGTCTTAGAAGCTGGG + Intergenic
1198872722 X:141193193-141193215 ACTTGAAGGGCTCAGAAGACAGG + Intergenic
1199185565 X:144911354-144911376 ACTTGGAGGTCTCAGAAGACAGG - Intergenic
1200499548 Y:3929046-3929068 CCCAGAAGTGCTCAGAAGCTAGG + Intergenic
1202344503 Y:23907198-23907220 ACTAGAAGGACTGAGTAGCCTGG - Intergenic
1202526265 Y:25762885-25762907 ACTAGAAGGACTGAGTAGCCTGG + Intergenic